GenePrediction:GLEAN_162 Details

Name: GLEAN_162
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1107223..1108167 (+ strand)
Length: 945
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1107223..1108167 (+ strand)
Length: 945
>GLEAN_162 class=GenePrediction position=GCSC_179:1107223..1108167 (+ strand)
ATGGGAAAGTACGTCCTCTCTGGTGTTGACGGCCAGCTCGGTAGTGTCGCCGCGCAGCATGTTCTGGCGCTTGCGTCTCC
AACGGACAAGCTGGTTTTTACCTCTCCCGTCGTGGAAAGAATTCCACCCGAGATAGCAAAGGAATGGAAAGACAAGGGCA
TTGAAATTCAGTACGCCAGCTATGACGACCCTGCCAGCATGGAAAAGGCTTTCGAAAACGCCGACACGGTCTCACTGATC
TCGACGTGGATGATTGGTGACATTCGGCGCAAGCAACACCGGCAGGCGGTTGCTGCCGCAAAAGCAGCGGGGGCCAAGCG
CATCTGCTATACCTCTTACATCGGCGCTGGAACCGCTGAGAACACTCCTCTTGTCGCATCAGATCACAGAGACACAGAAG
AGGCTATTGTCGAGTCCGGCATTCCTTACAACATCCAGAGAAACAACTTCTATTTAGACAACTACTTTCGCACCCTGTTT
CCCATGGCGCAGAACGTTTGTGGGGGCAAATGGCACTGGAACAGTAATGGCACTCCAGCCAGTTTTGTTGCCAAGGCCGA
CTGCTCCCGCGTTGTTGCTGCCCTTTTGCTGGGCAAGGGAGAGCCCAACACGATCTACAATGTGACCGGTCCCGAGATGG
TGTCTGACTACACCTTCATTGACATGGTGCGCAAGTACACCGGGTGGAAAGGTGAGCTTGTCGCATCAACGGACGAGGAG
CTCTACGAGTACTGGGGCGGCCGTGGCGTGCCCAAGACGGTCACCGGTGATTTCTCGAAAAGCCCGATTCCGCTGTGTGT
TGATGATATTGTAACGAACACGACCGAAATTCGGAATGGAACTATGGGTGTCGTGTCGGATGCTGTCGAGAAATTGACAG
GCCGTAAGCCATCGTCGTCGAGGGATGTCATGCTGCTGTACAAGGACGTGCTGCCAAAAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62