GenePrediction:GLEAN_1648 Details

Name: GLEAN_1648
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:232879..234988 (+ strand)
Length: 2110
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:232879..232902 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_144:233040..233082 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_144:233139..233249 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_144:234068..234132 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_144:234239..234988 (+ strand)
Length: 750
>GLEAN_1648 class=GenePrediction position=GCSC_144:232879..234988 (+ strand)
ATGGCTGTCGCACCGATCACCGGCGTACGTATGACTGATGGGAAGAGGGGCAGCAGACACATGGTCGCCCATTGGGAGAC
GAGGAGGAGAGAGGGACGGCGGACGACACGAAATGAGGCATTGGCTTGGAGAACGAAAGCTGACATTGCGGGATTTTCCA
GATGCTCCGCCGCAGGCTGATTGTTGACCTGACCGTGGCTCTCAGTACGTGCTATCTTTTGTTCCTCGTCAAGAACTTCA
TGGCTGACACATTTGTCCAGGTCTCGGCACGGCGGCCGGCAGCGCCTTCTGGTACGGCTTCCACATCCCCCGGACCGTTG
CGCGCGACACCCACTACCAGAAGCTGGAGCAGGAGCGCGCCGAGCGGACAGGTGCCTGAGCGCGAACAGCCAAGCGTGTA
CATAGCGGAAAGACAGGGAGAAGGGAAGAGAACAGAGAATGATTGTGAACCGTATCGATGCGTGCATCCGACCGTAGCTA
GGCTGATAAAGGCTTGGGTGAGACGTTTGATAGATTACAGTGGCCGGCTTGTCGTCGTTGCCTCAGGCAGAAACCCGTGG
CTCTTGTGTAGACGAGTCTCCATTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGCGGCTGCTGCTGCTGTTATCGACAT
GCAGCTGCTGCTCGCTGCCTTCCCACGCGGTCGTCTCGACCATGAAGCTGCCCGACCTATCCTGGCATCTAGAGACAGTC
AGACAAAGAAAGCCAAGGAAGAACAAAGGCACCCACCGTCGAAAGAGCCGCTGCACCGGCCAGCACCGCACTGGGCTGTC
CTGCTGCCGCGGATGCGCCACCGCGCAGCTGTACTGCACCATGGACGCCATCAGGGTGCAATCCCGGGCAAGGTCGACGC
CAAAGGGGCGGCCGTTGGCGGTGGTGCTAGCGGTGCTGTCGCTGTGCGGCGGCTTGCGCTGGCGGCCGTGCACGTCGACC
TGCACGCGGTCGGCCAGGTCGGCTGCCGGGAACGTGTAGCAGGGGGGCGTCATTCTGTAGCAGGTGCTGTGACGAGACGG
TCGATGCGTGTGTGTGTGTTGTCGTGTCTGGTTGGGATGTTCGAATTCGCCGAAAGAGAGGGGCTTTTTTAGGTCTGAAA
TCGACCTCGAAAACGACCAGCCGCACTTCTTGCCCCCAATCCCGATGGCTGCCACTGTCTGCGAACCAGCAGCTTCTGCT
GCGGCCGTCGGCCGTCGAATCCTGGCCGAGATTGAAGAAACCAGCCTGGAAGAGGTAGCTGTTCCGATTGTGTCCCGTCT
TGATCTTTCGCTGTCGGCTGTCTGCTGTCTGTCCTCTGCTCTCTGCTCTCCGCTGACTGTCCTTTCTCCCTCTGCCACAG
CTTCTGCACCAGATCCGGACAAGGACCAGCATCTATTCCGATCTTCCCAGCCCATCGCTGGACGTTGGTGCGGGAGCTCC
GTCTGCTGCTGCTGCTGCTGCTGCCACTACCACCACCACTCCCAGCATCCCCATCCCGGCTCTCCAGCGGCTCGTCACCG
CCCATTTCCGGGCCACCAGGTCGCCCGGCCTCGACATCGGCGGACCCCATCCGCTGCCGCTGTTGTATCTGCTCGTGGCC
GCCATCGTAGCCGCGCCGCGTCGCCAGGCCGTCATCGTCGTCGACCTGGAGGCCCGCTTTGACGTTGCCGCCCTGCTGGG
AATGCGTGCACGCATCGTCGATGTCGGAACCGATGCCGAAACCGATACCGAGACACCTGTCGAATCTGGCTCTCCTGTCG
CTTCAGATGACCTCCGACACGTCCACGTCTTCCGCGTCGATCCCCGGCTGTCGCCCTCGGCCGCCTCTGATGCCATCGCT
GCCGCCCAGCAGCGCGTGCTCTACGGCCCCCAACGCCTGCGCGACCGCTCCTGCTGGGGCACGCTCATCGTCGGCAGCGC
TGGACTGGCCGGCACCACCTCCAGCTCCGGCTCCGTCTCGGCGCGCACGGGCCTCTACGGCTGGCTGCGCATAGACGCGG
CTCTGGCTGCTCTGCCTTCGCCGCTGACCCGCCCCCCATCCGCTTCCATCACGTGGATCGCCAGCTCGCCCTGGGGCAGC
TTTGCTTTCCAGCTGCTCAGAGACGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62