GenePrediction:GLEAN_1649 Details

Name: GLEAN_1649
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:259524..261241 (+ strand)
Length: 1718
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:259524..259737 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_144:259794..261241 (+ strand)
Length: 1448
>GLEAN_1649 class=GenePrediction position=GCSC_144:259524..261241 (+ strand)
ATGGCCGAGTTCAAGCTCAAGGGCGTCACGTCGCTGGCGCTCAAGGTGGGTGAGAAGCAAGAGGTCGAGGTCGAGGGCCT
CGATGCCAAGGTGCTGCTGGTGAATGCTGCCGGCACGATCCAGGCCATCGGCCCCAAGTGCACGCACTACGGCGCGCCTC
TGGCCAAGGGCGTGCTGACGGCCAACGGCCGCATCACCTGTCCATGGCACGGAGGTAGGACACGTCGTTTCCGGACATGC
TCGCACACCAACAATGCTGACACCTCATAGCCTGCTTCAATGCCAAGACCGGAGACGTAGAGGACGCCCCGGCGCTGGAC
TATCTGCCGACCTTCCAGGTGGCCGAGCGTGACGGGGCCGTGTACGTGACTGGCGACAAGGTGGCCATCCAGTCGGGGCG
GCGAAAGCCAACGATCCGGCGGCTGGTGACCAAGACGGCAGCCGACGACGAAAAGGTCGTCATTGTGGGAGGCGGCTCGG
GTGCCATTGGCGCTCTGGAGGCGCTGCGCGAAAAGGGCTTTTCCGGCAGCATCACCATGATCTCGTCCGAGGGCTACCTG
CCCATCGACCGGCCCAAGCTGTCCAAGGCCCTGCTGACAGACCCGGCGAAGCTGCAGCTGCGCGATCAGGCCTGGTATGA
TGCCGGAGCCGTGACCGTGGTGGCTGACGAGGTGACGAGTATCGACTTTGGCGCCAAGACAGTGGCCACGAAGCAGGCCA
GCAGCACGCCGACGCCCTACACGACGCTGATTCTGGCCACTGGCGGCACCGCGCGCCGGCTACCGCTCGACGGCTTCAAG
ACGCTCGGCAACATCTTCACGCTGCGCAATGTGCACGACGTGCAGAAAATCGTCGGCGTGCTGGACGGCGGCGACCGGAA
GAAGAAGAACGTCGTCGTCATCGGCTCGTCCTTTATCGGCATGGAGGTGGCCAACGCCACGGCTAAGAATCACGCCGTGG
CCGTGGTCGGCATGGAGGCCGTGCCTCTGGAGCGCGTGCTGGGCTCGCAAGTTGGCAAGGCAGCCCAAACTGGGCTCGAG
AAGAGCGGTGTGTCCTTTTACCTGTCCGCGTCGGTCGACCGGGCGGAAGCGTCTGCGACCGAACCCGACAAGGTCGGCGC
CGTGCTGCTCAAGGATGGAACGCGTCTCGAGGCCGACGTGGTCGTGCTGGGCGTCGGCGTGTCCCCGGCCACCGAGTATC
TGCGCGACAACAGCGCTGTCAGCCTGCGACCCGACGGCTCCGTCGAGACGGACGAGTCCTTTGCCGTCGTCGGCCTCAAG
GACGTCTATGCTGTCGGCGACATCGCCTCGTTTCCCTACTACGGCCCCGCGGCCGAGGGAAAGCTGGTGCGTATCGAGCA
CTGGAACGTTGCCCAGAAGGCCGGACGCATCGCTGCTGAGCATATTGTCCGCCGGACCGCCAAGGCGAAAAAGTCGGGCT
CTTTCTTCACGCCCGTCTTCTGGTCGGCCCTCTCGGCCCAGCTGCGCTACTGCGGCAACACCGCCGCTTCCGGCTGGGAC
GACCTCGTGCTGCAGGGCAGCCTCGATGACGGCGCCTGGGCTGCCTTTTACACCAAGGGTGAGACCGTCGTCGCTGTCGC
CACCATGGGCAAGGACCCCGTCATGGTCCAGAGCGCTGAGCTGATCAACGTCGGCAAGATGCCGTCCAAGAGCCAGCTTG
CTGCCGGTCTCGACGTCCTCACGCTTGGGTCGCCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62