GenePrediction:GLEAN_164 Details

Name: GLEAN_164
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1111759..1112789 (+ strand)
Length: 1031
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1111759..1111825 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_179:1111949..1112374 (+ strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_179:1112428..1112789 (+ strand)
Length: 362
>GLEAN_164 class=GenePrediction position=GCSC_179:1111759..1112789 (+ strand)
ATGGCCGAGTTCGTTTTCGAAGACAAGGACCTGACCGGGGTCAAGGGCCAGGTTGTCGTCCTCACAGGTACGTGCTACTG
TGCTAGTATCTTACGAGTTTTCCGATACGAATGTCCTGCGTCGTAGGCTCGGCTCGGGCATGCCGCATATTGGCCACCTC
CGCTAACTGCTATCTGCCGTGACGTTGCAGGTGGTTCGTCCGGCATTGGCCTTGCCACCGTAGACTTGCTCCTGTCGCTG
GGAGCGTCGGTCGTCAACGGTGATGTCCAGCCCGCGCCCAAGGAGATCTCAGGTCCTTACACGTATGTGAAGACGGATGT
CAGCTCCTGGTCCGAGGTTCTGGAGCTCTTCAAGAAGGCCAAGGAGACCTACGGCCGCATCGACCATGTCTTTGCCAACG
CCGGCTTGGGACCGCGTGCAAACTACATCTCGACTGAGGTGGACGAGAACGGCGATCTGAAGCCGCCAACGTCGGCACTG
CTGGACGTCAGCCTCAACGGCGTCATCAACACGTCCACCATCGGCATCTTCTACCTGCGCCAGCAGCCCGAGGGCGGCAG
TATCACCATCACGGGATCCACGTGCGGCCTGCAGCGTCTGCGCGCCGTTGACTACTGTGAGTAATTCCCTGGCTCGACAG
ATCGACACACCCTTATTGACAACCGGCAGCCGTGGCTAAGCATGCCGTCCTGGGCTTCGGCCGAGGCCTCTATCCACTTT
TGCACGCCGCCAACATCCCCATCCGCGTCAATACGCTGGCGCCGAGTTGGGCCGAGAGCAACGTGCTGCCGAACTTGAAG
GAGCTGATGCAGGCTATTGACGTCGAGCTCCAGCCGGCATCCGCGGTGGCAAGGGGTGCCGTCCTGGTCATGTCCGACGC
CTCGCGCGACGGCCAGGTGATCCAGATCCAACGTGGCCGGTATAAGGAGATCGACGAGACCATCCTGCTGCCTGCATACG
ATACTGCCAGGGGTGACTACCCCAGCGAGGAGGAGGTCCTGCGACGCGCAGCCGCACTGGAGGCTGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62