GenePrediction:GLEAN_1652 Details

Name: GLEAN_1652
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:266862..269430 (+ strand)
Length: 2569
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:266862..266889 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_144:266949..267016 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_144:267099..269221 (+ strand)
Length: 2123
Type: CDS
Source: GLEAN
Position: GCSC_144:269283..269430 (+ strand)
Length: 148
>GLEAN_1652 class=GenePrediction position=GCSC_144:266862..269430 (+ strand)
ATGTCCTGCCCACACATCGCCTCTACCAGTTCGTCCGGCACGATCCCCTCTGCACGAGCGAGATGCTAACCGGCGGGCTT
GCCATAGGTCTCCGTCCCCCCACCCCAGCCCAGTCTGTGTACCGCGAAGACTGCACGCAATGCTTTGACTCGATCGTACG
GCAGCCCGTCGTTTCTTCTCTAATCTGTCTCTGTATGGCTGGCGGGGGAAGCTGGTCTTGCTGACTCTCGGGAGTAGGAC
GACCCCGCGGGCCTCGACGTCTGTCTGCAATGCTTCAACGGCGGCTGCGCCGGCGACCGGCACCACGCGAAGCTGCACAA
CCTCGTCTGGAGCCACCCTCTCGCTCTCAATATCCGGCGGACGCGCAAACAGATCGTCCGCGATGAGCCCCCGCCCAAGA
TGTCCAAGCTGGCCATCGCGGCCGAGACTGAGGCCGACCGCTACGACACCGCCGTCACCGTCAAGTGTCTCGACTGCGAC
AAGGAGCTCGACCGGACCGACGCCAAGCTTGCCCCCATCGTCGACGGCATTCTCTCGGCCAGCACGTTCTCGCGTAAGGA
GGAGGTTAAGGCCTGGGAGCAGGAGCTGACGACGTGCGAGCACATCCTCACGCTGCAGCAGACCGAAGCGCGCAAGATCG
CCTCGCAGGACCTCGGTCACTGTTCCCAGTGCGAGCTCAACGGGAACCTTTGGCTGTGCTTGCAGTGCGGAAACCTCGGC
TGCGGCCGTGCGCAGTTTGGTGGCGTCGGTGGCAACTCGCACGGCCTGGCACACGCGACCGGCTCTGCCCATGGCGTGGC
CGTCAAGCTGGGCTCCATCACACCCGAGGGTAGTGCCGACGTGTATTGCTACGCCTGCGACGAGGAGCGCGTCGACGAGA
ACCTGGGCGAACACCTTGCCCACTGGGGCATCATCCTGGCCGATCGCCAGAAGACGGAGAAAAGCCTGACGGAACTGCAG
ATCGAGCAGAACATGCGGTGGGAGTTCTCCATGACGTCTGAAGACGGCAAGGAGCTGAAGCCGCTCTTTGGTCCCGGCCT
GACTGGCCTCAAGAATTTGGGCAACAGCTGCTACCTCGCCAGCATCCTCCAGTGCCTCTTTGATCTACCCTCGTTCCAGA
AACGGTATGGCGCATTTGGGGATGACCTGTCCAACATTGCCGATCCGGCCCAGGACCTGGAGACACAGCTGCGGAAGACG
GGCGATGGCCTGCTGTCTGGACGGTACGCGAAACCCGACTCAGATGTGACCGCGTCCGAGAACACACCGGAACTCTCGTA
CCAAAAAGGACTGGCTCCGGCTATGCTCAAGCACCTGATAGGCCGTGGACACGAGGAATTCTCGACCATGCGGCAACAAG
ATGCATTCGAGCTGCTGCAACACCTGCTCAAGCTTATCACACGCTCCAAGCATCCATCGGCTGTGGAGGACCCCACGCTG
TCCTTCCGCTTCACTCTCGAGCAAAGACTGCAATGCCTCAGCTGCAAGAAGGTGCGGTATACGACAAATGAGCAGGACAA
CATCTTTATTGATATTCCCCTGGAGAAGCAGGCGGCCACAGATGCCGATGGTGGAGATGCTTTGGCTGAGGCCTACAAGC
CTGTGACGCTGAAAGAGTGCATAGACAGGTTCACTGGCGAAGAGGTCGTGGAGCTGACATGTTCAGCGTGTGGAAGCAAG
GATGGATATACCAAGCGTTCGCTGTTCAAGACGCTGCCAGAAGTTTTTGTCGTCAACGCACGAAAGATGGCCCTCATCAA
CTGGGTGCCAGTGAAGGTCGACGTGCCGGTCATTGTCGACGACGCGCCGTTTTTGCTGGACGAGTATCTTTCCAAGGGAC
GGCAGCCGGAAGAGGAGTCCCTGCCAGAAGATGCAGCGGCTTCATCTGGCGGTGGGGCGCCATCCTTTGTTGCGAATGAA
GAGGCCGTGGCCCAGCTCGAAGCGATGGGTTTCCCGCGTGTGCGTTGCAACAAGGCGCTCCACGCAACTGGAAACAGCGA
CGCGAATGCTGCCATGGAGTGGCTCTTTTCGCACATGGACGACGCCGACATTGACGAGCCGCTCGTTCTGACCAGTGCGG
GTTCCTCGGCTGCGACAGCCGACCCAGAGAAGATGGAGATGCTGATGTCGATGGGATTTGCCGAAGCTCAGGCAAAGAGG
GCGTTGCGCGAAACAAGCGGCGATGTGGAGAGGGCGATTGAATGGGTGTTCAGCCATCCGGATGCAACTGCAGACGACGA
GGCCGAAACCGAAGTGCCAGCTGAAAGTGGCGAGAAGGCCGTGGCTGGATCCAGTGAGACGCCCGCAAAGTACCAGCTGC
AGAGCATCGTGTGCCACAAAGGAACAAGTATTCACGCTGGGTGAGTTGCCATCATGCATTATATGGAAGCATGGATGATC
CTTTACTCATTCAATTTCTAGGCACTACGTCGCGTTTATCCGCAAGAAGCTGTCACAAAGCGAGGACAAGGTGTCCTGGG
TGCTATTCAACGACGAGAAGGTGGTGGAAGTTGTGGATGTTGAAGAGATGAAGAAGTTCGCCTACATATACTTTTTCAAG
CGCGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62