GenePrediction:GLEAN_1654 Details

Name: GLEAN_1654
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:278353..283101 (+ strand)
Length: 4749
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:278353..278472 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_144:278530..278576 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_144:278634..278771 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_144:278831..278897 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_144:278958..278998 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_144:279057..279574 (+ strand)
Length: 518
Type: CDS
Source: GLEAN
Position: GCSC_144:279620..279741 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_144:280185..280358 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_144:280563..282072 (+ strand)
Length: 1510
Type: CDS
Source: GLEAN
Position: GCSC_144:282131..282543 (+ strand)
Length: 413
Type: CDS
Source: GLEAN
Position: GCSC_144:282649..282894 (+ strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_144:282982..283101 (+ strand)
Length: 120
>GLEAN_1654 class=GenePrediction position=GCSC_144:278353..283101 (+ strand)
ATGTCTAGTAGCGCAGCTGCCCAGAATACCAGCAGCGGGCCTGCATCGGCCACCGCCAGCCCTGTGGCTGCTGCATTTCT
GACGGCAGATGAACCCATACTTGCGGCGGAGGTGGACGACGTAAGCAACGGCAATCAAAACAGCAGACTTTGCGCTTCAG
AAGCTGACGTGTGACAGGATGAAGGCCTGGACGACAATAGCGACTCAGCTTATGGTGACGAAATGTAGGTATATTCGTCC
TTTTGTACGCTCGCAAGTAGCTGACCTGTGCTCCTCTGTAGTTCGGCCTTGACGGCGTCTGTCTCCAGTAGCATTTTACA
CTATCGCACGCTTCATGGCCGGACCTTCAACAGCGACAAGTTCACGTCCCAGTACTTTATACCAAACGACGACCAGCAGC
AGACGTCGATTGATATAACGTACGATTATAACGGAGGCCTGTACCCCCACACAACACGCTGCTGACAACCGTGCACAGAC
ATCAGTATTTGACGTTGCTGTTAGACGGCGCCTTTTTCCTAGCGCCTATCCCACAGACTGTCAAGGTTCGAGCTAAGATA
CTTCGTATATCGTTTTAGAATACTTGAGCCTAACACGTTGTCTAGAGAATCTTGGATATTGGTACAGGGACAGGCATCTG
GGCAATGTAAGGAGGTCCCTAACTCTCACCCGCGCCACCCCTGGTTCTAATGAAAGTCTTTTAGCGACGTCGCCGACCAA
TTTCCTAATGCCGAGGTAGTCGGCACCGACCTCTCGCCGATCCAGTCGACTTGGGTACCGCCCAACACGAAGTTCGAGGT
GGATGATGCGGCTGAGCCATGGACGTGGCCTGAGAATTCATTTGACTTTGTGCACATTCGCTTCCTGAATGGAGCTATTT
CTGATTGGAACGCATTGTTTGCGCAGGCATTTAGGTGCTGTGAGCCAGGCGGCTGGTTTGAGTCGTGCGAGTACCACGTT
GACTTCCGGAGCGACGATGACACGACGAAACTACAACCGGCCCTAGGTCAATTATGGAATCTATATGAAGTAAGCGGGCA
AAAGTTAGGCAGGCCCTTGACGGTGGCCAACGACGGCACGCAGCAAAAGGCCATAGAGGCGGCTGGCTTCATAAACATCC
AAGAGAGAAACTTTAAGCTGCCCGTTGGCGGATGGCCTGCCGACCCCAAATTAGCCCAGATCGGCCAGTATACGCAGCTG
ACGATGCTGAACGACTTGGAAGGTATGTCCAAGTCTTGAATCGTTTCCCGAACTCGGGTGCTGACAGTGAGAGGGTACAC
AACGTTTATGTGGAACGAGGTACTGAAGTGGGGCGAAGCCGAGTACCAGATTTTCCTGATGCAAATGCGCAAGGCCCTGA
GAGACAAGAAGGTGCATTCGTACTTCACAGTCCGCTATGTGTGGGGACAGAAGCCATAGGGTTGCGAGCCGTTGGTAGGG
CTTTAGCGCATGTGAGCTGAGGAATCATTCTGTAGCGATGGATCGAACGTTGGAAGTGCGGAGAGATTACAAAACAAGTG
TAGAAATGATTAAGCATGGTCTGATTCCTGATTTCTAAAAGAGCAGCTGAGGATGGTCGAAGCCAATGAGGAGACGCAGC
GGGAGATTAGAGTGGAGAAGAGAGAAGAAATATCGCCCCGCGGACACGGAATTCAAGCTTGCAGCCGAATCCCGACTGCG
TCACTTCTAGACGTCTGACGGGGAAGACGAGCGAGTCTCCATTCCCAATTTTCCACCTCGTCCTCCCGGACAAAGACAGA
GCGGTGTGTAAGCAATCCTCGCCTTAGGTTTTTATTCCCTGTTGTATTTTCCGTGTGCTTCCGGCCGCCCAGCCCGTGGT
ACAGCTGGACGAAACGCCAAGGCTGAGAAAAGCGCGACGGGGAGCGACGAAAAGCGAGCTGAGCGATCGGGTGCGCCGAG
TGCGACGGACGGCAGGCCCGACGGTGACGACATATGCGCGACCGTCAATGGCGACGACGATGGACAGCAGCGAGGCGACA
GCGACGGTGAAGAGCGGAACAGGCAATCGCAGCGGGACAGCACGCAATAGCAGCGGCAGCATTGGCAGCATGAGCAGCAG
CGGCGGCAGCCGAGGAGGTGGCGGACTGAGCTTGGGGTTGGGGCTGGGTCTGGGTCTAGGGGCAGCAGCGGGGAGCAGTG
GGACACCGGCGCCGTACGGAAGGGCATGCCGCAACTGCTCGCGAGCCAAGTGCCGGTGCATCTACCGATCCGACGGCTGC
GGCTGCGAACGATGCTACCGACTGAAGAAGGAGTGCCAGGCAGCAGTGCCACTGCGACGACGAGCAGCGGTGCCCAAGAA
GACGGCCACGACGACACTCTCGCGAACGGCACAGCTTGAGCAGAAGCTGGACGGACTGGTGTCGTTGTTGACGGCACACA
ACAGCGCGATGGGAGGCGGATCGACGAGAACCGAGACGACCGAGACGACAGGGACGACAGGGACGACAGGAGCGACAGCA
ACGGTCAGCGAGAGCGGCAGCGGCTCGTCGACGCCGAGGAGAGACGATGGTGGGAACGGCAGCGCGGCGACGACGGAGAA
GATGGAGCAGGCAGTATCAGGCAGCAAGACGGGCTATCTGCCCGGGACGCCCGACTCGTCGGCATCGATGTGCTGCAAGA
CGGGCGCGACAGCAGTGCGACTGGGCGTGGCCTCGGCTCCGACTGCAGCGGCCGTGTCTGGCCCGTCGTCGACGACGATT
CCGCTCGACAGCTTCAACCACAACGCGATGCCGCTGACGACGACGAGCCAGACAGCGTCGGCCGACCCGGGTGGGCTGCT
GCAGCTGGATGAGGCGCTGGAGCCGACAGTGGCCGAGGCAGAGCGATGCCTGCAGACGTTCCGGCGCGAGATGCTGCCGT
ATCTGCCTTTTGTGCACGTGACGGCAGAAACGACGGCAGCGGCGTTGCGACAGGAGCGACCGCTCTTCTGGCTAGCGATT
ATGACGGTTGTGTGTCGTCACGTGCCGTGGAGCGTGCAGGTGGCACGATCGACGCGACTGCGCGCCCTCTTTGCGCAGCG
AGCCGTCGTCGACTGCGAGAAGAGCCTGGACCTGCTGCTGGCCATGCTGACGTACATATCGTGGGTGCACTTCTCGTCGC
GGCGCGACCGGCCGACGCTGTCGCTGACGCTGCAGATGGCCCAATCGCTCGTCAGCGACATGGGCCTGCACAAGGCCGTG
GCCTCGTGCAAGTCGCTGCTGGCTCGCTTCATGCGCGACAGCCTCGCCGTCGTCGTTGAAGAGGCCTTGCCGCCACCACA
GCCGCTGCTCGAGGAACGTCGCGCCGCCCTCGGCTGCTACGTCCTGTCGTCCGTCCTGTCGATCTCGCTGAAACGCACCG
ATCCGATGCGCTGGACCGCCCGCATGGAAGAACACGTCCAGGCTCTGAGCGCGGCCGTCGCCTCGTCTGCGTCTGCTTCT
TCCGATTCTACCTCTTCTGCGTCGTCCACTTCCTCTTCATCCCACCCCCTCGACCAGATCCTTCTCATCCAGGTCCGCCT
CCAGCGCATCGCCGACCAGATCTACCAGAGCGAGTGGCAGATGGCCGACCCTAGCTGCACCATGCCCGGGCCTAGTCCTC
CGTCGTCTGGCCTCCGCTGTCTCTTTGGCCATCGTGCCGTGCCGCTCTATGTTGCCCGCGTGCTCCACGGCAAGATTGAC
GATATAAAGGCATCTGTGCCCACAGACCTTTTGGCTCACGGTGAGTTTTTTTTTTTCTCTCTCTCTCTCTCTCTCTCTCT
CTCTACTCACATCTCTAGATGGCGTTCGTGGCCCCCTCCTCTGTGTCGAGGCCCTGCTTTCCGCCTGTGTCGTCACGGCA
CCGATGCCGCTGCAGTCTTCGGTTCCGGCAAACAACATCACCGCCACAACGGCCACGGCCTCCTCCTCGCTCCCCCATCC
CACCGCCACCGCTTTTGCCGAGTACGCCAACTACGTCGCGGCGACCAACGCGACCAACCTGGACCGCTGCGTCGAGGCCA
TCACGCGCTTCTGCACCCACTTTCTCAGCATTCCCAGCGATGCCTACCCGGTCGTGCCCTTTGCCTACTACACCTACTTC
ACCAGCTGCGTCATGCTGCTGCATAGCCTCGCCCTCGTCGACGACCCGTCCTGGGACCGCACCGCCGCCCACAGCCGCAT
CAATGTCATCGACATCCTCGACGGCTTCATCGTCCGCCTGCGCGAGAGCCCGCGTCCGCCGCTGGCTGCCGCTGCCATCC
CGGGCGTCGCTGCCGCCGCCGTCGCCGTGCCCGACTACAGCAGCGACATCTTCCAGCGCGCCATCTCGCTCGTCGCCGCC
CTGCGCGACCAGTGGGCGTCCGAGCTGAGCCGCATGAGCGCCACCGCCACCGTCCATGCCAGTGCCAACGCCAACGCCAA
CGCCAACGCCAATGCGTTTCCGTCTGGCCTGCCCGCCGTCTCCCAGACCTGGTGCGCTGCCGATCCCGTGGCTACCATCC
CTGTCGTCCAGCCGCAGCTGCAGCACCTCCAACAGATGCAGCAGCAGCAAAATAGTCCACAGGTACATCAGGCACACCAG
CAACACCAGCAACAACAACCACAACCACAACCACAACAGCAACCCGTCGACACCATGATGCCGCTGCAGACCGTCGACAT
GTTCTACCCCGACTTCTTCCAGACCATGGGCATGACCGAAGACTCCATCTTCTGGGACGTCATGTTCCCCGGCCAAGACG
GCTCGGCCGCCCAGCCGGCATACTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62