GenePrediction:GLEAN_1655 Details

Name: GLEAN_1655
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:283722..288986 (+ strand)
Length: 5265
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:283722..283847 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_144:283921..285611 (+ strand)
Length: 1691
Type: CDS
Source: GLEAN
Position: GCSC_144:285665..285699 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_144:286039..286286 (+ strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_144:286374..286652 (+ strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_144:286827..288986 (+ strand)
Length: 2160
>GLEAN_1655 class=GenePrediction position=GCSC_144:283722..288986 (+ strand)
ATGGCCGACCAAGATGGCCCCCCAACGCGGCTTCTCCGCACCGTCGACGACGAGGTCGCCGACCGCCAGGAGACCGTCCA
CAATCTCACCTCGCATGCGTTTAAGGACTGGCCAACCGAGGCCGGCGTACGTCATATTCTTCGAGACATGAAGCAGCTGT
TGTCCTCGTCTTGCTCTTCTTCCCCGCTGACTCTGCCAGTTCGACGGCCTCTGCGAAGAACGCGGTCCCCTCGAGATCCC
TGTCGTCGGAATCATCCCGCCTTGGGCTGCCGGCAACTTGTACCGCACCGGCCCTGGCCAGCTCAAGCTCGACGACACGC
CCAAAGGCACCCACTACATCAGCCACTGGTTTGACGGCCTGGCACATTCGCACCGCTTCGAGATCGTTGCCAGCAGCGAC
CATCACCACCACCACGGCCGCGTCCGTGTCTTCTACTCGTCACGCCGCCAGTCCGAGGCTGTCGCTCGCCGCATCCAGCG
CCAGGGCCCTGCCAGCCTCTTCAGCTTCGCCCAGCGCCGCAATCCCTGTGTCACTTTTCTCGGCAAGTGCATGAGCACCT
TTCATGCCGCCATCTGGCCCGGCCCGTCGCACTTCAGCGACTCGGACAATGCCAATGTCGTCGTCCTCACAGACTTTCCT
GCTGCCGTCGGCAAACCGTCTTCTGTCTCGTCCTCATCTCCCTCCGGCCATCGCAATACACTCCCCTCTAACGTCTGGAT
TACTACCGATTCTACTATGATGCGCCAGGTTGATCCGGCCACACTCGAGCCCATCGGCTTCGCCATCCAGGAGTGCCTGC
ACCCAGATCTCAAGGGCCAGCTGTCGGCGTCCCACGCTCAACGTGATCCCCTCACCGGCGACATGTACAATTTCAACCTC
CAGCTCGGGCCCACGGCCATCTACCGTGTATTCTGCGTCTCTGCCGCCACCGGCAAGACCACCATTCTCGCCACCATCCG
CTGCGCCAGCAATGCCGCCGCTGGGCCGCGCCCCGCCTACATCCACTCCCTCTTCCTGACGGCCCATTACCTCGTCCTGT
GCATCCCCTGCACACACTTTGCAGCCTACGGCCTCAAGGTCCTCTGGGAGCACAACATTGCCGACGCCATCGAACCCTTT
GATCCAGCCCGACAGACCCGCTGGCTCGTCATCGATCGGACCAGCAAGACCAGCGGTGTCGTCGCCGATTTTGTGAGCGA
CGCCAGTTTCTTCTTCCACAGCGTCAACGCGTACGAGGTCGAAGAGAAGCATGATTCTAGCGGCAATGACCCACAGACCA
CGCTTATCTGCGACGTTGTCGACTTCCCGAGCTTCGACATCGTCCGGGCCTTCTACTACGACGTCTTGCTGAATCGAAAC
GGCGCGGCCAGAGAGCTGTACGACGATTCGGCTGTGGTGGAACGCGTGATCCCTTCGCTGTCACGGTTTCGCCTGAAGCT
GCCCGTTCGGACTGCCGGCGCCAGCAGCACCACTGCCACGGCCGACCGTCTCTGGTCCATCTCTGGTCCTCATGCCGGCG
AACTGCCCACCATCAACCCGGCCTATGCCACTCGGCCACATCGCTTCGTCTACAGCATGTGCACTCGCGGCCTCTCCACC
CTGGCCGACGGTCTTGCCAAAGTCGACACCACTACCCGCACGTCGCTGCTGTGGGCCGCCCCTCCAAAAAACGTGCCCGG
TGAGGCCATATTTGTGCCGCGGCCGAAAGAGGAGGGCGGGGGTGAGAAGGAGGACGACGGAGTGTTGTTGTCCGTTGTGC
TAGACGGACAGGTTGGCTCGAGCTACCTGTTGTGTCTGGACGCACACACCATGACCGAGATGGGCCGTGCCGAAGTCGGC
TTCGCTATCGGCTTTGGCTTCCACGGCGTTCACATCAATGGCCGACATTTGTAAAGTTGTTCGGGGCACGTTGTTTGCAA
TTCCAATGTCTGAGTCGATGTAGATGCTTTTCTGTTGTACGGTCACCACCTCTGATTAGTAAGCAACATAAACCACCCGC
TTGTGGAAGGAACATGTCACAAAACTGCCCACTTGTACCTTCCGACGCAGCTTCAACACAATGTATTATGATGCTGAGAC
TTCCTCTCAAAAGAGAAAGACATATCTGACATTGAGGCTTTCCTTGCCACCACAAATTAAAAGAGACAAAAGAAAACTAA
GGGTAAACTCTCACGAAACGAATCCCAGCAAACCATACATATCAATCCCTTCATAAAACTTTCCATCCACACCCGCACAC
CATCACACTACCATACTACCAATCGTCTTTTCCCTTCCACCCAAACTAAACAAAACTCCTAATTTCGCTACATTCAGACC
ATTACCCTCAAGACGAGGTGCCCGACAATATACCGAAGGCTGTTTCCAAACAGCTGACGATCGACGCGCCCGTGGTCGAT
CCGGAATCGCTTGCCAAACACGTGGCCGCGTTACCGGCATCGTACGGACCCAAAGCTACTGCACAGAGCGCCGTGTCGAT
GACGAGCGTTGCCACATCTGTGACGGTGGCGAGATCCGAACAGGCAGTCGGCAGGGAGGTCGGGCAAGATGCCTCGAGAG
CGTTGGTAAGACAGTCGACAACGGAAGAGCCGCTGGCACTCGTGCTGAGTGCTGTCGTGGCCAAGCACGAAGCCGCATTG
CCGATGCCGTAGGCTCCGAGAGCAGTGGTACACTCGGCTGCCTCCAAGATGAGATTGACGAGGCCGTCGGCATCCGCGAG
CTGCGTGCAGTTCGGCGGCAGCGTGACGCTGCATGCGGCCGAGGTTGTGGCCGACGTGGTCGCCGACGTCGACGAGGAGG
TCGCCGACGTGACTGGGCAAGACGCCAAAGCGACTGTGCTTGTCGCCGTAGTCGTCGTGGTACCAAGACCCAGGGCTTCC
TCGAGACAGGAGTACATCTCGGCGCCAGACAGTGCCGACGAGGCAAAACAGGTCAGCGTTGTCCCAACGGCAAACGGACC
CAGCGCGGTCTGACATTTTATGGCGTCAGCAGCCACGTCGAGGACGCCCGCAGTCTCAAGGGCGTCACAGTCAGAAGGCA
GCGCGGTGATGCATGTATCTGAGGCGGCTGTCTCCAAACAGGTGTAAACGTCCTGGGCTTCTGAGAGCGACAACGGTGTC
GTCGCCAAGCATGTTCCAACGGCGCCTGTATCGTACAACGCAAAAGCAGCTACACACTCTGTGAAGTCGACCCCGTATGT
CAAGACTGAGGCCGTCTCGAGGGCTGCGCAAGACGTTGGCAGAGTCGTGATGCAGACTGTGGCTGTTGCCGTCGTCACCG
ACGTCACAGTCGTGGAGCAGGTCGTGGCGGAAGAGCTGGACGATGGGCTCGACGACGTAGATGAGGCCGAGGAAGAGATG
GGTGCGCTGGACGATGAAGTCGCTGATGAAGTGGGCGCAGACGTGGACGGCACCGACGAAGACGATGAGGGAGCAGACGA
CGACGAAGTTGGAGCGGACGAGGTCGACGAAGCTGACGAAGACGAGACCGACGAAGACGAGGCCGACGAAGACGAGGCCG
ACGACGAAGATGCAGACGACGAGGCAGATGAGCTAGAAGCAGAGCTCGATGATGAAGCCGAAGATGACGCCGACGTCACG
GACGACGATTGCGAAGACGAAGTACTCGAGGACGAAGCAGGCGGCGAAGACGACGCTGATGAAGCAGAGTTAGAAGCAGA
GCTAGACGACGTCGCACTGGAAGTGGGCTGTGAAGATCTGCTGGATTGCGAGCTCGAAGTGCTCGAGGTACTGCCTGAGC
TAGAGCTGGGAGTGGAAGACACAGAGCTGGAAGCAGAGCTTGAGGCAGAGCTGGAGGCAGAGCTGGAAGCAGAGCTGGAA
GCAGAGCTGGATGTAACACTCGACGACGCAGAGCTAGATCCACTGCTCGAAGAAGATGTGCTAGAGGTGGAAGCAGCACT
TGCACTGCTTGACGGACTCGTGCTTGGTGAGGAAGTGCTTGATGGGCTAGCACTAGATGATCCAGAGCTAGAAGAACCAG
TAGAAGAAGCGGAGCTTGAGGATGCAGAACTGGATGCAGAGCTGGACGATCCAGACGAAGATGGGGTAGATGAGGCACTA
GAGGACCCCGTGCTTGACGAACCAGTGGAAGAAGCAGAGCTTGAGGAAGTAGAGCTAGAGGCGGAGCTTGACGAACCAGT
GCTTAATGCGGAGCTAGATGATCCAGATGAAGACGGGGTAGACGAGGAGCTAGACGATCCAGTGCTTGACGAACCTGTGC
TCACGTTAGAAGTGGAGCCAGTGCTAGAACCAGGGGTGGAGGAAGCGGAAGACGAAGAGATGGGACCGGTGCTGGAACCT
GTGCTGGACGATCCGGTGCCAGAGCCAGTGCTGGAGCCAGTGCTAGAGCCAGTGCCAGACCGGGTGCTAGAACCACTACT
GGGTCCTGTGCTGGACCCAGTGCTAGAGCCAGTGCTCGAAGAGCCACTGCTAGAGCTAGTGCTGGAACCGCTGCTGGAAC
CAGTGCTGGAGCCAGTGCTGGAACCGCTGCTGGGTCCTGTGCTAGATCCGGTGGTAGACCCAGTGCTAGAACCACTCGAT
TCCATGCTAGAGGTAGTGCTGGAAGGGGAGCCAGAGCTTGACGAACCAGTGCCCGAAACAGGAGTGCTTGATTCGCTGCT
CTGCGATGTAGACGAAGACAGTCCCGGGGTCGAGGATGAGCCAGAGGAGCTGCTTCCAGAGGAGCCGGTGCTGGAAGTAC
CGGAGCCCGAGCTTGAGCCGCTAGGCCCAACAGTGGAAGAGATACTCATGGCAGTGCTTGAGCCACCTTGGCTGGAAGCA
GCAGGGGTAGAGGAGCTGCCAGGGGAGGACGAAGATCCAAGGGAAGATGCAGAGCCAGAAGATGAAGAGGGGCTAGATGA
ACTACCTGTCGAGCTTCCAGAAGAAGGCAACGTACCTGACGAGGAGCCTGAGGTTGGGGTCTCTACAATGATGGTTCCGA
TGGTGCCAGATCCAGTGGGCGGAATGGAGATTGTCAGCGTGGTCGAACCAGTCCAGCCGCCAGTAACAGTGCTGAAAGGT
CCTGTGAAGGTAGAGCTGCCGGGCGACTCAACGATGACGGTGCCGACCGTTGCTGTGCCCGAAGGCGGCAGCGTCAGCGT
CGTCGCTACAGAGCCGCTGTACTGGCCCGTCAGCGTTGTGTACGGGCCCGTGAAGCTGCTGCTGGGCGTCTCGACAATGA
CGGTGCCGACAGTGCCGGAGCCGGCGGGTGGTAGCGTCACCGTCGTGGCCACCGAGCCACCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62