GenePrediction:GLEAN_1657 Details

Name: GLEAN_1657
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:300038..302749 (+ strand)
Length: 2712
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:300038..300155 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_144:300316..300458 (+ strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_144:300519..301341 (+ strand)
Length: 823
Type: CDS
Source: GLEAN
Position: GCSC_144:301390..301665 (+ strand)
Length: 276
Type: CDS
Source: GLEAN
Position: GCSC_144:301716..302749 (+ strand)
Length: 1034
>GLEAN_1657 class=GenePrediction position=GCSC_144:300038..302749 (+ strand)
ATGGAAGGCAGCAATAGTGAGAAGTGCCGAAAATCAGACGCGATCATTCTCACATTTGCCTGGTACAAGTTCAACATCTC
ACGAGATGGACAGTCAGACACAGGCTATGCACAGTCAGGTAGCAATCATGCGGACGTCAACCATAGTCAGCCCAAAACCT
ATGCGAGCATACAATAAGAGCAGGACGTGGCCGAGTGTTTTGCAGGCAAAGCTGGCTTGGAAATAAGTCGGCATATTTTG
CCTCAATCACTGACAGGCACATCCGTTGTTCTTGATAGGCCATGTGTTTCCCGGCGCCGCTCTGCCGTTTGGTATGGCCA
AAGCGGTAGCCGACGTAAACACAGAGCTGCAGGGAGGCTTTGCGTCGGACGATGGCGAGATCACGGGTTTCAGCCACATG
CACGACTCAGGAACGGGAGGCGTATGTTTCCTGCGTGAATTGCAGCAGCTTCGTGTCGTCTTTTGCTTCTAACCCATACA
GGGCGCCCGTCTCGGGAACTTTCCCATCTTTGCGCACACGGGCTGTTCTGGCGACGTTCTCAACAATTGTGCCTTTACGG
CGACAGACCGGGCCGTGAAGCGGGTGCCGGGCAGCGTGGTGGCCGAGCCGGGCTACTTTGCCGTAACGCTCAACACGTCG
GTTCGCGCGGAGATGACGGTGACAAATCACACGGCGCTGTACCGGTTCACCTTTCCATCGGACAGGGCCAACCTGCCCTA
CAGCTACAGCCCGCTGGTTCTGTTCGACCTGAAGGACCTGTCGGACTCGCGTATCAACGGCAGCGTCGCCGTGGATGCGC
AGACGGGCCACATCACTAGCAACGGCACCTTTGGCCCGTCGTTTGGCGTCGGCAGCTACGATTTGCACTTCTGTGTCGAT
TTTCACGGCGCAGACGTGCGCGACAGCGGCGTCTTTGCTAACAACCGTGCCGGCAACACGACGCAGTCGCTGCGCACGTT
TGCCAACGGCGTCGACGTGCCACCAGTGCCTGCTGGCGCTTGGGTGCAGTTTGCGCCACCCGCGGCTGACGACCAGATCC
TCGTCCGCGTCGGCCTCTCGCTTGTCAGTGTTGGCCAGGCTTGCACCAACGCCGAGAGCGAGCTGACCGGGCCCGACTTT
GACTTTGACGGCACGCGCACGGCAGCCGCCGATGCCTGGCGCGCAAAACTTGCGGTCGTGCAGATCGACGACAGCGGCGT
CGACAACAATCTCAGCACGGTCTTCTGGTCAGGACTCTATCGTGCGATGATCTCACCACAGGACTACACGGGAGAGAATC
CGCTGTGGCATAGCAACGAGCCTTGTGAGTGGATAAAAGGCAGACAGGGTCAGATAGAAGGCTAACGATCAGATTACGAC
TCGTTCTACTGCATCTGGGACTCGTTTCGGTCAATTCACTCGCTGCTGACATTGGTGGACCCGCAGAGCCAGACGTTGAT
GGTGCGTAGCCTGATCGACATCTACCGACACGAGGGCTGGCTGCCTGACTGCCGGATGAGCCTGTGCAAGGGCCTGACAC
AGGGCGGCAGCAATGCAGACGTGGTGCTAGCCGATGCCTATCTCAAGGGGCTGACAGACGGGATCGACTGGGATACAGGC
TACGAGGCAGTTGTGAAGGATGCAGAGGGTGAGTGAAGAGGAAAGAAAGGAAGAGAGACCAACTTGCTGACCCTCCAGTC
GAACCGCCAATCTGGAACGTCGAAGGCCGAGGAGGCCTGGCCAGCTGGAAACAGTGCGGCTGGAGTGGGCACGTTCTCGC
GCAGCATCAGCCGGACGGTCGAGTATGCGTACGACGACTTTTGCATCGCTCAGATGGCGGCGGCCATGGGAAAGCCGGCA
GATGCGGCAAAGTACCGACGGCGAGCTGGCCAATGGGCGAACCTGTTCCACGACGAGCAGCGGTCGTTTTGCCGACGGGC
GGCGGCAACGAGAGCGCCAAAAATTCCGAAAATTCCGAAAGTGCCGAAACCACCGACAGCGGCTTTGCCGGCTTCCTGCA
GCCGCGTTTCCTCAACGGCACCTTTGGCTTCCAGGACCCAGCGCTCTGTCAGCCGCTGCTCAACTTCACATCCTGCTACC
TCACCACCAGCGGTCACGAGATGTACGAGGGCGGCAGCTGGCTATACACGCTTTACGCGCCACACGACATGGCCGCTCTG
ATCGGCCGGCTCGGTGGGCCCGATGCCTTTGTCGCCCGGCTGCAGTATATCCACGACACGCCCGGGCTGCTCTACATGGG
CGACGAGCAGGCCTTTCTGCTCGTCTTCGTCTTCCATTATGCCGGCCGGCCGGCCCTGTCAGCTCGCTATGCCCACACGT
ACATCCCAGCCCAGTTCAACACCACAACAGTCGGCATCCCCGGAAACGACGACAGCGGCGCCATGGGCGCCTTTTCCTCG
CTCACCATGCTCGGCCTCTGGCCCGTCGCCGGCCAGGACGTCTACCTCATCACCCCACCCTTTTTCCGCGAGGTCAGCGT
GACCAGCCGGCTGACCGGCCGCATTGCCACCGTGCGCTGCCGCAACTTCGACCCCGCCCCGGCCAACATCTACATCCAGA
ACGCTACGCTCAACGGCCGTCCCTACAGCCGCAACTGGCTCTCTCACCGCTTCTTCTCCGACGGAGGCCTGCTCGAGCTC
ACTCTCGGGCCCAGCGAGAGCGCCTGGGGTACGGCCGAGGCCGATCTGCCGCCGAGCATGTCTACCGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62