GenePrediction:GLEAN_1658 Details

Name: GLEAN_1658
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:303171..304142 (+ strand)
Length: 972
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:303171..303222 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_144:303281..303641 (+ strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_144:303698..303883 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_144:303950..304142 (+ strand)
Length: 193
>GLEAN_1658 class=GenePrediction position=GCSC_144:303171..304142 (+ strand)
ATGTCTACTGCTCTGCTCAAGGGTACCGCCTTCATCACCGGCGCCGCATCCGGTGCGTCCTAACCGCCCCGATCTGTCAT
CCTCCTGCTGATTTTCCTCTCCATCTACAGGCATTGGTCGGGCCACCGCCTTCGCCTTTGCGCGCCATGGCATCGAGAAC
CTCGCGCTGGCCGACGTCGACATCGGCACTCTGCAGGCATCCAGCAAGGCCCTGAGCGAGCAGTTTCCCCACGTCCAGGT
GCTCGAGCTGCAGCTCGACGTCGCCCAGGCCGCTGCCGTCCACGCTGCCATCGCCACCGTCGTCGACCGCTTCGGCCGCC
TCGACATTGCCGTCAACAACGCCGGCATCAGCGGCAGCGGCCGGAAGACCCATGAGGTCGACGAAGCCGAGTGGCGCCGC
GTCATCAACGTCGACCTGGACGGTGTTTGGCGCTGCCAGAAGGAGGAGCTGGTCGTCATGTTGAAGCAGGAGTGCGTGAT
GGTGAGCCGGTCAGCAGCAGGAACACGACGCGCTAATACCCTCCTAGAGACCTCGGCCCTCGCATCGGTCGCGGCCGCAT
CATCAACACCTCGTCCATGTACGGCGTTGTCGGGATGTTCGACCTGGCCCAGACGGCCTACTCGACGGCCAAGCACGGCG
TCATCGGCCTCACCCGCTCTGACGCAAACGCCTACGGCCCCATGGGCATCCGCCTGAACTGCATCTGTCCAGGGTAGGTG
TCTGTGTGTTTTGTGCTTGTATATATAATATATTACTAAGCGCATCCGCACTCCTGCAGATTCATTCGCACCCCGTTGCT
GGAAAATGTTCCCGGCGATTCACCCATCATGAAGGATGTCGAGCGATCGGCCCTGAGGCGCATGGGCCAGCCAGAGGAGA
TTGCCGATGCTATCACCTTCCTGGCCTCGCCCATGAGCAGCTTTGTGCAGGGCGCCAGCATGGTCGTCGATGGCGGCTTT
ACTACGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62