GenePrediction:GLEAN_1659 Details

Name: GLEAN_1659
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:306204..308487 (+ strand)
Length: 2284
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:306204..306958 (+ strand)
Length: 755
Type: CDS
Source: GLEAN
Position: GCSC_144:307023..307831 (+ strand)
Length: 809
Type: CDS
Source: GLEAN
Position: GCSC_144:308117..308487 (+ strand)
Length: 371
>GLEAN_1659 class=GenePrediction position=GCSC_144:306204..308487 (+ strand)
ATGTCGAAATACGAGGCGATGGGTGTCGACACCGCAGCAATAGCTGCAGATCCCTCCCGGGTGGTGGACGGCTTGGTCGG
TGCAATCAAGTCGATTGCAGCTGATCCCAACTACCAAATCTTGGCTGATGTCTTCAATGAAGTGTTGCAACTCCGTACAA
AAAACCGGGAGCTCGTCGACACAAATCGCAACGTTTTCGAGCAGTACTGGCAGTTCCGCAATGAACTTGAGAAATCACGG
GCTGAGATAGAACACGCCAAAGCTGCACTTCAAGAGGAGCTCGCCTGTAAAGTCAAGGAGTTGGCCGATCTGACAGACAC
GCATAACAGCCTCAGTACAGAGCTCTCCAAAACAAAGACGACACTGGGAGAGGCCATCGACAACAAAGAGACTCTTGAGG
CCGACGTGAGCACTACAAAGACGGAGATTGATGGGCTACGCACCACACTTGCCACTCTCAAGGAAGACCTCAGCCAGGTC
ACTTCAAAACTGGAGGAACAAAAGCACGTGGCTGCTAAGACCGAAGAACAGAACTCAACACTGAAGGCCTCGCTCTTCGA
GCGAGAGGATGAGTTGGAGAAAGTCAAGAGCGACCTCCAGACGACGGAGCAACAGCTCCAGGAAGCCGTTTCCAGAGGCG
ACGGTCTCAGAGAGACCCTTGACCAGACCCAGCATGAGCTCACAGCGAAGACAATGCGTCTGATAGAGCTGAACAACTAT
CGAGTCGTCATGAAAGAGGAGCCAGAAGACGTGTTGTACGTATATTTCAAGGTTATTGTGTTCTGTTTCTATTTGATCGT
TCCAAAACTGACAAAAAAGCGTGAAAATTCTCGACAACGTTTGGACAAAAGTGTTTGATTTGGTCGAGTCACACTTCCAG
CAGGATCTTGCCGACCATGTCCTAAGCGATGCTTCACGCTGGAACAACCTTCGCAACGCTGATGCACTGAAGGGCCCAAC
CCAATTCCCGCTACCCCAGACCAACTCGCCGATTGCAAAGGCGATGCGCATTGCTGCCGTCCTATCGGTCCTCTCACGTA
CACTGTACCGATACATCTTCCGTCCGTTCTACCTTCTCCGAGACGACGAGGAGTTCACGGACCTTCTGCACGAAGTCGAA
GACGACAACCCGACCATGGAGGAGAACATCCGGGCCACACTGCTGGCAACGATGCCAGAGGTCCAGCAGGCCAGTGCCAA
GGCTCGTGCTCAGCACGTAGTGCGGGAGGTCTCTTGGGTGGTCCAGCACCTTCTGGACGCCATTGCCTACAAGAGCTTCT
GCACCAGCCTGGGAAGTGCCTGTGCCGTGGCCTGCATCGAATGGCAGAAGATCCAGCGTGCCAGGACGAAGATCGAGCCG
TACTTTGGGCCGCCATACGACGATTTTGACTGGCAAGAATTGCCGCTGCCAGAGTTTGACGGACGCTCCAGCACCACGCG
GCACCGCAGTCGTGACAGTAGTGTTACGCGCTGCGAGTCTCGGGCACGTGGAATAGAGCACAGCGATCTGGAGGTGCTGT
CCGGTGCAAACGACAAGGCAGGTGGCGATGGCGTTTCTAAGAAGAGTGCGGCAAGCAAGCTTGTGTCAAGGACTCCATCG
CCACAGCGTGTCGAGGGAAAATCAGGAAGTGAGACTGACAGCTGGGTAGACTTCATGGGTGGAGAGGGTGTTAATCATGG
GCGTGGCAATGGCGATGGCGATGGCAATGGCAATGGCAATGCTCCCGGTGACAATGCTTTCAATGGCGACGTCAACGGCA
ATGTCGCTGGCGGGATCTTTAATATCAGTGGTGCTGTCTACGATAATAGCAGCGGTGAGGATGGCACTGGTGATGCGGAT
GGCAGTGGCGATGTTGCTGGCGAAAGGAATGACGAGAACATGACGGTGGCTTGTGCTCTTTCTCCTTCTCTAGCTCCCGT
TTCTGTTTCTGTCCCTGAGATTATCGCAGATGTGGACATGCAGCATGAAAATGCAGCGCCTATCAGCGAAATGGACGAGG
ACAGTGAGGTTGACCCAAGCGATATCATCCTGGTGGTGTGGCCAAGCATGGTGGTGGTAGAGAACGGCGAGCAGTCGCCC
ATCACACAGGGCCTGGTGATCTCCAAGCAGCAGGCGAGCCTGGCGTACCACGAAGTCCGCATGGCACGTATTGGACACCG
CTCCTACTCCAAGCGGTCCCGCACCCTGTCCATCCCGTCGACGCCAATTTCGAGCGTTGTGGGCGGCTTTAAGCAGGACT
TGTCTTTTCTAACCGAGGTTGGCGAGAGGGAATCCGTCGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62