GenePrediction:GLEAN_165 Details

Name: GLEAN_165
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1118221..1120425 (+ strand)
Length: 2205
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1118221..1118773 (+ strand)
Length: 553
Type: CDS
Source: GLEAN
Position: GCSC_179:1118856..1118867 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_179:1118936..1119886 (+ strand)
Length: 951
Type: CDS
Source: GLEAN
Position: GCSC_179:1119987..1120019 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_179:1120070..1120425 (+ strand)
Length: 356
>GLEAN_165 class=GenePrediction position=GCSC_179:1118221..1120425 (+ strand)
ATGACGACGACCGCGGCCATGAAACGAAGGCTACAAATTCGGTCCCTGTCTGTACATCGCACCCTCACAATGGTGCGTTG
TCTCTACTCCCTTTTCGAGTTTCTATCTATACACTTACAGCCTGTTGCATCACCCTTTCATACAGACAGTTTTCGAAAGG
TAATCAGCCGCATTGATGATCACGATGCCGAGACACGCTGCCGTGAAGAGATGACCGACAACATGGCTGGACAGCCCATC
CACGGCCGCAGCTGTGACCGTCCCACAAGACATGATAGCAGTGGAAGAAGCAGCAGCGAAACTCTACCAAACGACAGCGA
TGATGCCTCGGACCCCGATAACCTTATTGTATCCTGGGAAGATAACGACCGCGAGAACCCGTATAACTGGTCGACGGGGA
AAAAGCTCTCCACCCTCACAATATCCCTGTTAATTGTCATCAACAGCAACTTGGGAACGTCCCTGCCGAGCAATGCAGTG
TCGTATATTGTGGCCGAATGGCCAATCTCATCGACAATTCAAAAGGTCCTGCCAAATTCAATGTACCTTGTTGGTGAGTA
ACATTTTACCATTTAATGGGCTGCCTCGTAGCTCGACCTTGACCACATGACTGACAGCACGGCTCCTCCTTATAGGCTAC
GTGTTTGGTAAGTGCCGTATCGTTCCATATTCTGATCCTGTCCCTGATTGCGCCTATTCTCATGCAATCCCTTAGGCCCG
CTTGTGTGGGCTCCTCTAAGCGAGCAGGTGGGCCGCCGGCTCATCATGGTTTTTACCTTTTTTGTCTTCATTGTCTTCAC
CATGGCGTGTGCACTGGCGCCAAACTGGCCCGTCTTTCTGGTGTTCCGCCTTATCTGCGGCGTCTCCGCCTCCTCACCTG
TTGTTCTGGTGGCCGGCGTAATGGCCGACATGTACGGGGACCCGAAGACGCGAGGCCGTGCGGTCGCCGTGTTCTTGGGA
ACAACCTTGATTGGCTCTCTGACGGGACCCATTGTGTCCGGGTTCTGCGCCCCGGCCATCGGCTGGCGCTGGAGCTTTTG
GGTAGCGCTCATCTTTGCCGGCGTCTGTGCGGGACCGCTGCTGCTGATGCCCGAAACATACGGACCCGTGCTTCTCGCCC
AGCGGGCAAAAAAGATGCGTCGTGAGGATGGGTTCGACGATAGTTCCGCGTCGGCTCCGAAGCGTCCAGGCCGCCCCGTT
GCCCCCCACGAAATCGACCTGGCCGGCCAGTCGTGGCGTGAGCTGGCCAGCGTTGTGCTCACTCGCCCCTTGCGTATGAT
GTTGGGCGAGCTGATCGTCAGCTGTGTGTGCGCGTACGTGGCGCTGGTATATGCCATCTTCTACATGACCTTCCAGGCCT
TTCCTCTCATCTTCGAGGGCATCTACGGCTTCTCTCCCGGAGTGTGCGGCTTGATCTTCTTGCCCATCGGCTCTGGTGCT
CTACTGATGGTACCCATCTTTCTTGCATACGACCACTATTTGCAGGTTGCCGTCACCCGCGGTGAAGCCTGGACGCAGCG
TGAGGAGTACCGCCGGCTGCCGCTGGCCTGTCTTGGCGGTCCGTTGTTTGTCGTGAGCCTCTTCTGGCTTGGCTGGAGCT
CACGCAGCGACGTGTCGTTTGTGGTGCCCATGTTGGCCGGAATTCCCTTTGGTATGGGCTTTTTGCGTGAGTTTTTTTCT
CAATGTTTTGCTATGCTTTTATTATTTCTCTCCTGTCCCGTTTGCCATTGTTTTGGCAAGCGCATTCATTTATTGACACT
CAGCAGTCATCTTCATGGCATTGACCAACTACATCACTGGTGCGTTTGACTTCCGCTCTGTCCTCATAGTGCTGCCACTA
ACCTTGCAGATGCATACGAAATATTTGCCGCATCAGCTAATGCCGCCACATCCACGACCCGCTCGCTATTGGCCACTGTA
CTACCACTTGCTACCACACCACTCTTCACACGCTTAACGATCTCAGGTGCTTGCAGTTTACTCGGCGGTTTGAGCTTGCT
CATGTGCGCCATCCCCTTTCTGTTCATCTGGAAGGGCGAGCGCATTCGTGCCGGCAGCCACTTCTGCAATGTGCTGCGTG
AGCGCAAGGCCGATATGGAGCGCAAGGTTGAGGAACAGCGTCACAGACAACCCGCACTACAGGGGCCACTAATGAAAATG
GAAAAAGTTGCCAGCGCCACGGAGCGAATAACCATGTCTGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62