GenePrediction:GLEAN_1661 Details

Name: GLEAN_1661
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:317903..319616 (+ strand)
Length: 1714
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:317903..318053 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_144:318315..318556 (+ strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_144:318657..318935 (+ strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_144:319119..319616 (+ strand)
Length: 498
>GLEAN_1661 class=GenePrediction position=GCSC_144:317903..319616 (+ strand)
ATGGTGGTGCCGAGAGGGAAGGATCACGGCGGCGTGTCTCTGCGGTCACGACAGGCATCCGGACAGGGGAATCAACGCTT
CTACTTTGTGAACGTGCTGTCTGACTACGTGGCGGACCATTATCTAATGCCCCATGCTGGAAGTGGTGATGGTAAGTGCT
GACGTAATTTCCAGTCTTTCTTTCCTCTGATGGTGCCCACTTCGACAGGCAAACGAACAGTTCTCTTTGGGCACCAATAC
AACAACATTCCGCAAGTCAGACCGGCGATCCGGCTGAGTATTCCAAGCTCGCTCTATGCGGATGTATAAAAGTGTGAAGC
AGAAGGCTCCAACTGGATATCTTACTGTACGTCGGTTCACTCATGCATTGCTTGTAAACTTGCTATTGGTGCGCCCTTAT
GTGGCTCTTTAGTCTACCACGAGGCATCCATGTCTTTGCCACAACTTGACGCCAAGCCCACAAAGTTTCGGGACCTGCTT
CTGCGCATGTCTCTAAAGGATGACTCTGCTTCGTCTCGGGCCCTCTTGTATTCTATTTTCTGCCTCTCGGCAGTACGGCG
CTACGGAAACGTGCAGGAATGTTCTCACTTCAAAACCCTGGCCCTTCAGGCACTTCAGCACGCTACCACCAAGACAACTC
TCACTGTGTCTCAGGTCTTGCAACACGTGGCGGCCGGGCTGCTGCTTTGCCGCTCAGAGGCAAGAGATCCTGCCTCTGGC
ACAGATTACGGAATCTTGCTGACCCATTTCACAGATTGCTTTGGGCGATCAAGCCACTGTCTTCTGGGCCATGTATATCT
GCAACCTGCGCACAATACTGGTTCATGCATTTGTAGACCCATTGCCTGTGCTCTCCTTGAATGCAGGCGAAATAGCCGAT
GCGTTCATCCTCCTCCGCTACGTTCACTACCACGACGTTCTGGCCCAGTTTAGCATAGACCATTGGCGCCGTCCGGCGGA
TCTGCTCGACCAGTTATCGGTGATGTTTAAAGGGAAGCAACTGAAATTCCGCTGCTCTCAAGCATCAGACATTGTAAGCG
GTCTCCCTCCCCACGCAGTCCTAATTTTCTCCATTCGCTGACAGCGTGTCCCATTAAGGTTGTCAACCAATATTTGGGCG
AAGACATTCACGCAGAAATACATCTCTTGTCAGCAGTATTGAATGCGTCCAAAATGGTCCATACGAGCCCGGCCTGGCGA
TCGAGATGCCCAGCAGAAACTCGTCTTCCTGAAGACAGAATTAGAGGAAGCCTTCAGCAAAAGCAAGAAAGCGTGCCGCA
ATGCAGTGGATATGGACGGGTCGGATCCCTCTGTCAACGTGGCGCTGCAGAGGTTCCTATTTCTGTCCGCCTGTTGGATT
TACTTCCAGAGAGCATGCAGGTATCTTTCCGGTCCCTCAGTTACGATGGACTCGCTGCTGGTCGACGTATTTTCTATGGC
TTCGCATATCCAAAGAATGGGCGTCCGCATAACGCCCTTTTCCCTGTTTATGATCGGCAGCGAGGCGAGGACGGAAGAAA
GTCGTCGCTCTATCCTCGACCTCGTCAATCAACCCCAAGGAATAGACGATCCGTCTACAAACTGTGTGAACCTCTTACTG
TCGGCTGTCTGGGCACAGGATGATCTGCACGACAGCACTCAGGGCTATCTAGACTACATCACAAAGATGGAATGGGTTAT
CACAGCACGGCCAGTTCTTCCAGCACTCGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62