GenePrediction:GLEAN_1662 Details

Name: GLEAN_1662
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:319959..321907 (+ strand)
Length: 1949
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:319959..320082 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_144:320248..321170 (+ strand)
Length: 923
Type: CDS
Source: GLEAN
Position: GCSC_144:321273..321584 (+ strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_144:321641..321907 (+ strand)
Length: 267
>GLEAN_1662 class=GenePrediction position=GCSC_144:319959..321907 (+ strand)
ATGTCAAACGGAAAGCACAGTCGCGCGGAAGAGGAGAACGGCGGTCGCGTGGCGACTACGCCGGCCAAGAAAGCCAGAAA
GGTGGAGGTGGACGGCGAAGTGCGGAAGGAAACGGTCAAGGAGAGTCTGAGACGGGAGAGAAAGGAGAAGAAGGAGAAGA
AGAAGGAGAAGAAGAGGGAGAAGAAAGAGAAGAAGGACGATACGAAGGACGAGGGCGAAGACGTGAGCGAGAAGAAGGAA
AAGACGGAAAAGAAGGAACGGAAGGAAAAGAAGGACAAGAAGGCCAAAGAGGCGACCGAGGCTGTCACCGAAGCAGCCGA
GGAGGCCGAAGAAGAAGTTGAGGCAGATGCTGAGGCGACAGGAACGACAGGCACGAAGCTCCAGTACAAGCAGACGGCAG
GGCTGACGGCACTGCCGGAAAGCGAGATCCAGGCGTTTATGAAGAAGGAGCAGGTGGCAGTGACAGACCCGCTGGCGAAG
AAGGACGCGGGAGTGCAGGGCGAGCTGCGGCCGATTTTGGAGTTTGGACAGCTGCCGGCGACGAAGTTGACGCGACAGAA
GCCGTTTGCGGAGTACAAGAAGCCGACACCGATCCAGTCGGCATCGTGGCCGTTTACGCTATCGGGTCGCGACGTGGTGG
GAATTGCAGAGACGGGTTCAGGCAAGACGATGGCGTTTGCGCTGCCATGCGTGGAGGCGGTGCTGCGAGCGGCGCGGCCG
GAGGCGATGGAGGCGAAGAAACTGCCGAACCGGTCGAAACTGAACAACAAGTGGGACGGCAAGGGCAACGTGGCGCAGGC
GCGGGCAGTAGTGGTGTCGCCGACACGAGAGCTGGCAATGCAGACACACGCGGCGCTGGCGCCGTTGGCAGCACGTGTGG
GCCTGACGGCAGTGTGTCTGTACGGCGGTGCGAGCAAAGACGAGCAGCGGGTGCAGCTGCGACAAGCCGGAGGAGTGGAC
GTGATCGTGGCGACGCCGGGACGACTCAAGGACTTTCTGGCAGACGAGGCAGTCTCGTTGGCGCATGTGTGCTTTGCCGT
GTTAGACGAGGCCGACCGGATGTTGGACACGGGTTTCGAGGAAGACATCCGGCAGATCCTGGGTCAGTGTCCTGACCGGA
CACAGCGTCAGACGCTCATGTTCACGGCCACGTGGCCGACCAGTGTCCGTGGCCTCGCCCAGGGCTTCATGGTTGATCCG
GTCAAGATCACGGTCGGCAGCCGGACCCGTGGCAGCGGTGACGGCGAGGACGGCGAGGGTGGCGGTGCCGGTGGCGGCAG
CACCGAGCTGCAGGCCAACGCGCGCATCGCGCAGACAGTCGAGGTCATGGACCAGCATGCCAAGGAACGTCGTGTCCTGG
CCATCATCAAGCAGGAACAGCGCGGTGCTGCCCGGAACGACCGCATCCTCGTCTTCTGTCTCTACAAGAAAGAGGCCGTC
CGGGTCGAGAACTTTCTACAGGGCCAAGGCGTTCGGGTCTGCAGCATTCATGGCGACCTGCGCCAGGAGCAGCGGACCCG
CAGTCTTGAAGCTTTCAAGACGGGCCAGACGCCAGTGTTGGTAGCTACCGATGTAGCAGCGCGTGGTCTCGACATTCCGG
AAGTGAAGCTGGTGATTAACGTGACGGTGAGTCTTTTTTTTGTCAGTTCTGTTCTCTCGTCCGTCCTCGTCTGACCATAC
AGTTCCCCCTCACCATCGAGGACTACGTCCACCGCATCGGTCGCACTGGCCGTGCTGGCAAGGATGGCCGGGCCATCACC
TTCTTCACCGAACATGACAAGGCACATTCTGGCTCGCTGGTCAACATCCTCCGGGGCGCCAACCAGGAGGTGCCCGACGA
CCTGCTCAAGTTCGGCACGACCGTCAAGAAGAAGGCTCACGGCACGTACGGCGCCTTCTTCAAGGACGTCGACATGAGCC
AGAAGGGCACCAAGATCACGTTTGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62