GenePrediction:GLEAN_1663 Details

Name: GLEAN_1663
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:331760..333645 (+ strand)
Length: 1886
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:331760..333488 (+ strand)
Length: 1729
Type: CDS
Source: GLEAN
Position: GCSC_144:333545..333645 (+ strand)
Length: 101
>GLEAN_1663 class=GenePrediction position=GCSC_144:331760..333645 (+ strand)
ATGTCTGTCGCGGCAGGCCAACAGCGCCGGTCAATCGACCTCGACTCGATTCCGGCCGAGGAGGATGTCGCCGAGACGTC
TGCCCTGCTCGGTAGCGAGAGCAATACCGCGGTCGGATCCGGGTCGACGTCGCCGCCGCGCAAGGATAGCTGGAATGGCG
ATGAGGACTTCAGAGGCCTGTCTTGGTGGAGGCGCCCATCGGTCTACTGGCTCATCGGTCCATACGTGCTCTTCACGCTG
GCCTACGGCGGCATCTTGGTGCCGCGTCTGAACCTGATCATCGGACTCGTCTGTCGCGGCTATTTTGCCGACCGCGAGCA
CAGCGACGGCCTGCAGATGCTGCCCATCGTGCCCGGTGCCGATAACCCGCAGTGCCAGGTGCCTGCAGTTCAGCGCAGCG
TGGCCACCTTCTCGCTAGCCATCAGCGTTGTGTCCGGCTCGCTGGGTGCATTCACAGCGCCGCGCCTGGGCGCCCTGTCG
GATCGATACGGCCGCAAGATGATCCTAGTGATTGCATCGTGCGGCGGGCTGTTTGGCGAGATCATCATCATCCTGGCGGC
CAAGTATCCCGACGTGGTGCACTACAACTGGCTGATCGGTGCAGCGGTCATCGACGGCTTGGCCGGCTCCTTCACCACCG
GCAGTGTGGCCAGCCACGCGTACACAAGCGACTGCACGCCGCCGTCGAGGCGGAGCGTATCCTTTGGCTACATGCACGCC
TGTCTGTTCACCGGCATGGCCGCGGGCCCGTTTCTGGCCGGCTACTTTGTCGAGTGGACCGGCTCGCTGGTGTCCATCTT
TTACGTGGCCTTGGGCTGCCACGTTGCCTTCATCGCCTTCATCAGCCTGCTGCTGCCAGAGTCGCTGTCGCAGCGCCGCC
AGCTGGTTGCCCGAGAGAAATACGCGCTGGACGGGCAGGACAAGGCAGCCAAGGCCAAGGCCCGGGAGGAGGAAGAGGAA
GATGCCTTGCGGAAGCTGAGCCAGACGCCCGGCAGCACGGTGCAGCGCGGCCTGGGACTGCGCCTTGCGGCGTGGCTGCG
GCGGACGAACCCGTTTGCGCCGCTGGCGATCCTGTGGCCCAAGGGGACCTACAACACGCGAGTGCGCCGCAATTTGCTGC
TTCTGGCCGCCATCGACACGGTGCTGCTGGCGGCGGCAATCAGCATCGGCAGCGTCACGCTGCTATACAGCGAGTATCAG
TTCCACTGGGGCAACTTCCAGACGTCGGCTTTCATGTCGCTGTTATCGACGGTGCGCGTGGCCGTGCTGATGGTCATCTT
TCCGGTCATCAACTACCTCGTGCGCACACGGCCGGCGGCCCGGCTGCGACGCCTCTCGGGCGAGGAGCCGGTCGAGGCCA
ACACGGGCGCCGACGAGCTGGACGTGTGGCTGATCCGCAGCGCAATCCTCTCAGACGTCTTGGGCCTGACCGGCTACATC
TTTGCTCGCTCGTCGGCCGTCTTTGTCCTGTGCGGCGTGGTGACGGCTTTTGGCGGCCTCGGATCGGCCACGGTGCAGTC
AGCGCTGACTAAGCACATTCCCGCCGACCGCATCGGCGAGCTGCTCGGTGCCATCGGGCTGCTGCAGTCGCTCTCGCGCG
TGTTTGCGCCGCTGGTCTTCAACAGCCTCTACGCGGCAACGGTGGGCAGCTTTCCGCAGGCTGTCTTTGTGCTGGTCGCC
GCCGTCTTCGCCACCCTCCTGCTGCTGTCCTTTTTCGTTCGTCCACATGGTAAGTCGGCCCCGACGGTCCGGTGCACGCT
TGGCCCCACAGCTAACGCCGTTCAGTGTTCCTATCCGACTTTGAGGAGGCGGCAGAGCCGCAGCCCGACCGTCTTGCCGA
GGCAGACGACATTCTTGTCGAGGAGACTGTTGTTCCTCAGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62