GenePrediction:GLEAN_1666 Details

Name: GLEAN_1666
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:346388..347885 (+ strand)
Length: 1498
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:346388..346432 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_144:346521..346991 (+ strand)
Length: 471
Type: CDS
Source: GLEAN
Position: GCSC_144:347049..347885 (+ strand)
Length: 837
>GLEAN_1666 class=GenePrediction position=GCSC_144:346388..347885 (+ strand)
ATGAAGTTCCGGAGGACCTTTCGGTTTCACGGGCTGAAGCGGCCGGTTCGTTCTATCTGGACCTGACCTGTCTGCGTCTC
GTGCTTTTGCTCTGGCTTTTGCTGGCTTCTGACCTGACATCTCTCCCTTTCAGCGTATCCGCCAGACATGGAACAAGTAC
AACCTGTTCAATCTGCACCAGAACCTGCGGATGCCCCGCCTGATCCAGAAGACGTTCTTCCAGCAGAAATGGGACGCCAA
GGCGCTGTCCCGCGGCTATCACGGCGAGCACATCAAGGAGCGCCAGTGGGAGCGCATGTTCAGCCGTCGTCTGGCCTCGG
TCGTCGACATGAACCCGCGCTACATGGCCGAGTTTGACGGATCCGAGCAGGCCGAGGGTCGCGGCAGCGGAAAGCAGCGG
GATCCCAGCGCTGGCAGCCCGCAGCTGGCCCCATGGGCCGGCACCAATCTGCGGACTACCCAACCGACGCCCTTTATGCA
GATGACCTTTGCGCCCATGGAACGGCGTCTCGACATTGCCGTCTTCCGCTCGCTGTTTGCCAGCAGTGCCCGTCAGGCCC
GCCAGTTTGTCGTCCACGGCGCCGTCCGCGTCAACGGAAAAAAGGTAGCCCTTTTTCTTGTCTTCTTGCCTTGTCTGCCT
TTTCCCCGCTCACACTCCCAGATGGTCTACCCCGGATACCTCCTCAATCCTGGCGATCTGTTCCAGGTTGATGTCGAGCG
CGTCCTTTTTGCTACTGGCGCTAAGAAGGCTACTCGCCGAGCCGACGTCCGCGCACGAGAGGCCCGGCAGGCCGAGAACG
ACGAGGACGATGCAGCCGAAGACGACGCAGCCGAAGACGTCGACGCAGCAGCCGCAGAAACCCTTGCTGTCGACGGCGTC
CACAAAAAGGCTGTCCGTGAGCTGCCTTATCTTGCCGCCCGCGCAAAGTACCTCTTGGCCAACGCCAGCGACGACCTGAC
CGTCAAGCGGAAAAAGGCCCTCCGTCAGTTCGTCAAGGATGCCCGTAAGTGGGTTGCCAAGGCATCGCCGTCCGCATCCT
CCTTTTCTCCCTCTGCAACGAGCCCGCCGCCATCCTCAGCCATTCTCGACCGCCTCGCCGATCTGCTCGCCAGCACTAAC
CTCGGACCCGACCACACCACCGCTACGGTGTCCGAGCAGCCGGCCGGAACGACCGCAACGACTGCAACGACTGCCAAGAC
CGCCAAGACCGCCAATTCATCCCTGTCCGACGAAGAACGCCGCCGGTTTCACAAGCTGATTGCTCGCGATGCCGAGAACC
CGCTGGACCCCTCAAAGCCTTACGCAACCCCGTGGCGGCCCCGGCCCTTCATGGCTCCCTTCGCCTTCATCCCTCGCTAT
CTCGAGGTGAACCAGAACATCTGTGCTGCCGTCTATCTGCGCCACCCCGTCGCCCGTCCCGGCATGGCCGAAGTGCCCAC
GCCCTTCCCTTACGAGATCAACCAGCTGGCATTCAACTGGTACCTGAGGCGCCACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62