GenePrediction:GLEAN_166 Details

Name: GLEAN_166
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1126885..1128985 (+ strand)
Length: 2101
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1126885..1128426 (+ strand)
Length: 1542
Type: CDS
Source: GLEAN
Position: GCSC_179:1128478..1128702 (+ strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_179:1128797..1128985 (+ strand)
Length: 189
>GLEAN_166 class=GenePrediction position=GCSC_179:1126885..1128985 (+ strand)
ATGGCAGAGTTGGCCCTAGCCGTCGTTGGTCTGGCTGTGGCCGTGCCGGCCATAATTGAGCCGACAGTGCGCTCGCTCCG
CTTCATTCGCGAGACTCTGCATAAGTACCGTTCAACCGACACGATCCAGGCACGTCTCATCTTGCAGCTCGACCTGCACC
TTGTCCAGGTCGAAAACCTGGCCATGTTTATCTACGGTACATCCGGAGACGGTAATGGCCACAGCGGCCTGGTGGCCACA
CTGGATCCGACGTCACGGGCTGTTCTGGGTCGCGTCATCGACACGCTCAGCCGCCTTCTGGAAGACTTTGCCGAGCAGTT
GTCGACGGCGCTCGACATCCGTGGAGGCCGGGTCATCGGGCGGGCACGGCGTCTGGCCTTTGCCTTTCGTGGTCGCAGCG
ACCCTCTGCAACAACTGCTTCGCGAGTTGGAGTCGTGGGAGCGCAGCTTCAGCAACGTCGTCTTCTCAGCCTGTCTGGCC
GCTGGCCGCCGGCTCCCGACTGGACTCGATAGCGTGACCACCACCCCTGTGCGCAGTACCACTGCCCCAGTCTCTCAGTC
GCCTCCGCCGGTTTACTCTCCCCTCGAAGCGCCTACTGCACGCCGTCCTATTGCCGAGGATCTCACCGAACTCATCCAGC
GCTGCTGTGTCCTGAAGCAGCCCCCAACAAATTCGCCCCCACTGCGTCTCGTCCCCGTGTCCCGGGATGGCTGCGCCCCT
GTCCGCCATTCTGGACTGCTCTTCCACAACGGGTTGCCGAGCTCCGACGGTGTACAGGGTGCGCCGCACTTTCTGGAGAC
GCACCAGCCCGGCTCCGTCATGTCCAACACGGATGAAGAAATCCGTAATATTGCCGCGTTCTTGCGTGGTGCCAACCCCA
GACTTGTGGCCTTGCTTCCCTGCCAGGGCTTCTTCGTCGAGACGGAACAGCAGCGGTTCTACAATCCTGACGGCAGCAGC
TTTTCCCTGCCTTCCTACAGCACGCGTACACTCCTCTTCAGTGTGCCGCAAGGATTGTCGTCGCCACGCTCGCTGCGCGA
CGTACTGCTCGAGGCGCGCACGTCGGAAATCAGACACTCGCTGGACGAGCGCGTGGCTCTCATGAAAAAGCTCGCTTCGG
CACTGCTCTTTATTCACACAGCTGAACACATCCACAAGAGCATACGGGCAGACAATGTTGTGCTTCTGAGGGAGGCAAGT
ACCGAGACAGAATCTGAACAAAAAGGATACGGCTTCCTCCCCCGGACGTCGGAAATGGTGATAGGTGAGCCCTTCCTGGT
TGGCTTTGACCTCAGCCGGAAGGAGGCCCGCCACTCCGATATGAAGCCGACTGTCGATCTCCATAAAACATACTACCTTC
CCGTCGACCGTCAGGGAGCCCCTGTCCGGCGCTACTCCATGCTCGACGATATCTACTCGCTCGGTGTGCTCTTTCTCGAG
ATTGCTCTGTGGCGGTCGCTTGTAGAGTTCGAGCCGCAGGAGCAACGGCCGGACACATCTGGCCTCCACGTTAACGACGG
AGGAGACACATGTGGGAAATGGGTTGGTACTAGCTTGTTACTCGACTGTAATGGACACCCTCTTCGTCCCCAGGCCTTGC
ACCAGCGTCTCGTCACACTAGCCCGTGAAGACGTCGCACGACGCATGGGTTCTATTGTGGCGGGGCTCGTTGTCGCCTGT
CTGATGTGTCTTGATGCCAGCAAGGACGAACATGACAACGAGTGGACTTCATTCGGTCAGCGGGGTGATCTGGCTGACCA
AGACGGCATCGTGCTGGGTCAAGCATACATTCGCAAAGTCATCATGGTTTTGGACACGGTGTGTCTATAGATGCCGATTA
TACATCACAGGGGAGACTTCTGGCTCCCCTTTTGAATTTGTCTATATCTGCTCAAGCAGCAACCACCGTCAGGCTCTCTG
GTGTGTCTCCCTGGTGCCTCCAATTGGCCTGCACAAATGGGGGGAGGACTGGGATCCTGTCATAGACTCGCTTCGACACT
GGAAATCAGTCAAGGTCAGCAGGAGCAAGGAACACATCTGCCAACGTCAGACTGTTGCCAACAGAGTATTTTCCGGCACT
CGTCTCGAGAACCGCTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62