GenePrediction:GLEAN_1674 Details

Name: GLEAN_1674
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:399590..400127 (+ strand)
Length: 538
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:399590..399865 (+ strand)
Length: 276
Type: CDS
Source: GLEAN
Position: GCSC_144:400008..400127 (+ strand)
Length: 120
>GLEAN_1674 class=GenePrediction position=GCSC_144:399590..400127 (+ strand)
ATGATCAGTCGATTCTCTGCTGACCGCGGCTGGCCTTCCGGCCCTCTATACTGGGTCCAGGCCCAACCTTCACGGAAGTC
GACGTTGCTTTGGCGCTACTATACTATCTTCCCTGGCACCTCGGCCGTGAACCACATCAGGACATTCTGTGCTTGTCCTG
TTTGCCACGCCGCCGCCCAACAGCAGTCTGCTTCTTTCGACCATCGAGTAAGGCATCTAGGGGTCCTGCAGACAGACAGC
CCCATCGACCGAGACAACACGCTAGCAAGCGATCGAGTACGAGCATGGAAACCCCCTAGACGGGCAGAAGAATAGACCAC
CTACTATCTCGTCTCCACTGCGGCTGGACCGATCCTTAGTTGCCTTGGTACCCGCATAAGGATGAATATGTTTGGGGATC
TGCGTTCTTCTGCGACAGTTTTCCGGCGAAGGAAAGAAGGAGCCGCACTTCCGCGTGCAAGACATCGCCGGTAACAAGTA
TGGCACTCAGAACCAGGCCGGATTTGAAGCAGCAGCCTTGGTCGCCCAGCACAGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62