GenePrediction:GLEAN_1675 Details

Name: GLEAN_1675
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:401133..402206 (+ strand)
Length: 1074
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:401133..401796 (+ strand)
Length: 664
Type: CDS
Source: GLEAN
Position: GCSC_144:401983..402206 (+ strand)
Length: 224
>GLEAN_1675 class=GenePrediction position=GCSC_144:401133..402206 (+ strand)
ATGGCCGTCTTGAGCCTCACGAAGAGAGGCCGGAAGACAGCAAAGGATACAGCCCAGACCCAGGCAGAGACGCAGAACGA
GCAGCCACCACGAACGAAGTATTGGCATGTTCCGACCCACGCGGCAACTGATGCCCTCCTCGGCGCCCCTTCTGGCTGGA
ACCGGGAAGATGCGTCCAAGATCCGCGAGCACAATCGGAGACGCAGTGCCATCAACCTGGCCGCCCAAGGAAATGCAACC
GGGTCACGCCAAAACATGCTGAGCCCTCTGCATGTAGACATAGCCCACAGCTACAGTACCAGAAGCTTGGACGGAGCCGG
CGTTGGAAGCAGCAACGGTGCCAGCAGTCCCAGCAGCGCCAGCAGCAGCAGAGGTCCCGGCCAGTGGTCACGATCCAACA
GCGGCCTCTCCAAGGTGTCATTTCCAGCCGGGCCAGCAAACCCGGTGGTGCACATGTCGCAGAGCTACAAGAGCATGGAC
GCTGCACTGCACAAGGACGGCTTGCTCACGCCGGCGTCGGCATCCCGACCCGGATCAGTTCTCCGAGCGTCTGCCTCAGG
GAGACAAGTCGACTACGATCCCAAAAGTCGGATACCGACTGTGCCGTCATTGGGGTCGCTGGCAGCGTCTGCATCACTTT
CGTCTGGCGCACAGGAACGCAAAGGTGCCTCATCTTCCTCATCCACCTCCACATCATCTTCCTCGTACCCTTCTCATGCC
ACCAACACCAACAACTCTTCCAACACGTCCTTGTCAGAACCGCGCCCTGATTCGGGAATGTTGCCAGATGCCAAAGATAA
AGGCAAGGGAAGACGTTAGGGCTAACAACACCAAATTTTCTTTACGACAGACTTGTTTTTGTACGGCAACTCCGATGTTT
TTGAGATGAAGACTATACAAAAACAACCAGACCATCACGCCAGTGCCGTGCTGTCAAGTGACGGCCCGTCGTCGCTGTCG
CTGACGTTCCCTGCACAGCAGGACCGGTCTACCCTTCCGTGCTCCCAATCACCCGCACCACGTTCGCGGTTTGGCAGAAT
CGTTCGCAGTGGTGCCGCTGCTGTCGCTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62