GenePrediction:GLEAN_1676 Details

Name: GLEAN_1676
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:403641..404176 (+ strand)
Length: 536
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:403641..403665 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_144:403734..403829 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_144:403914..404176 (+ strand)
Length: 263
>GLEAN_1676 class=GenePrediction position=GCSC_144:403641..404176 (+ strand)
ATGTCTGCCAACAAGGAATCTGCTGGTAGGCCTCCCCACCCCATTGTGATCTGTCGGGTGTCCTGGAGGATTCTAACGTT
TGATTTCATGCAGCTTGGCCTCTGGCTGATGCGGCCCTGACCCAGGAGATCCTCGATCTGCTCCAGTCGGCCACTCACTT
TCGCCAGGCCAAGAAGGGTGCCAACGAGGGTGAGTTTTTCTTTGTTCTACTTGCGCATCTGCGCATCAATTATCTGCTCT
AGATTTTGTTATTAACAATGCGCGCTTCTACAGTCACCAAGGCCCTGAACCGCAACACCTGCGAGATCGCGATCCTTGCC
GCGGACGCCAACCCGCTGGCCATCCTGCTGCACATCCCGCTTCTGTGTGAGGATAAGAACACGCCGTATGTGTTTGTGCC
GAGCAAGGTGCAGCTTGGCCGCGCCTGCGGTGTCAGCCGCGCCGTGATTGCGGCCAGCATCAACACCAACGAGGCCAGCG
ACCTGGCCGGCCCGATCAAGGCTCTCAAGGACAAGGTCGAGCGTCTGGCCATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62