GenePrediction:GLEAN_1678 Details

Name: GLEAN_1678
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:418481..423326 (+ strand)
Length: 4846
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:418481..418758 (+ strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_144:418829..421749 (+ strand)
Length: 2921
Type: CDS
Source: GLEAN
Position: GCSC_144:421963..423326 (+ strand)
Length: 1364
>GLEAN_1678 class=GenePrediction position=GCSC_144:418481..423326 (+ strand)
ATGAGCTCTATAGACGGGATGGCCAACGTGGTTTTGGCGCCTGTTGCTGACGCCTCGGTGTCGGTTCTGTCCTCCGCTGT
GGCCACTGCTGGCGAGGTTGCAGCTAATCATGGCTCTACCTCCTGGATAGGCCTCTTTGCGAGGCTAATCTTGGCCATCC
TTCACCTGGTGTCGACCATCTTGTACTTTACGATTAAGTTGACCACCTTCTCGATCCCGACCATTCTTTTCACTTTGTTC
TCCACAACACTGACGGTGACAATGAACGCAACTACCTTGTGAGTCACTCTGCTCTCAGCTGAAGTTGTGAGCCAGATCGT
TGAGTGTTATTGCTGACTTTGCTTGAAGGATGCTTATTGTGTTTGCCATCTTCTCTGGAGTGAGCTGGTTTGTACGGTAT
CGCTACCTTAACGTGTATGCCCGCCTTCCACCGGAGCCGCAGAGGAAAGAACCGGATGTGGACCTGTTTCCAGACACCCA
TGATGAAGGGATCAAATCAGGCCTTTCTAGCTATCTTGACGAATTTTTGAGTGCCATCAAGATTTTCGGATACCTAGAAC
GGCCGGTCTTTCACGAGCTCACCAGAAGCATGATGACAAGGAAGCTGATCGCCGGCGAGACGTTAAACCTTGAGGAAGAA
AAGGGATTCTGCATTGTGGTTGACGGCCTTGTTGAGATTTTTGTGAAATCGTCTCGGCCAGGCAATAGTCGTCAACATTC
AGGACAGTCACGGCGCGGAGTGTCTCTCGAAACTGCGTCTAGCGACGACGAGAGCTCTTCCCCTGCACAACAGCGGTACC
AGCTCTTGACTGAGGTTCGAAATGGTGCTCCCATGTCGTCGCTCTTTTCCTTGATGTCTCTTTTCACCGAGGATATCGAC
CTTCGGCAATCCGAGGATGACACTACACACGACGTTTCGGATGCTCGGAATAATTCCATGCGGTATCCGGCTAGTGCTGG
CTTAGGGTTGTCGCAAGATCCGCGGACTGCATTCTCACAAATGCCACTTGTGGATGAGCCTTCCGAAAACGTCAGGCCTT
CCGAGCCCACGGCTGGCTCGAATTTACCGCCAGTCCCGCATATGAACTTGGACTCCCCTCCACATATACGGAGGCCGGGG
CTGAAACGCACGGCTACGAGCTCGGTGCACCCTGACATCATTGCCCGGGCCACGGTTGACACCACAATTGCAATCATTCC
GGCCAGTGCCTTTCGGCGGCTCATTCGCGTGTACCCCAAAGCCACCGCTCATATTGTTCATGTTATTCTGTCGCGTTTTC
AGCGGGTCACGTTGGCGACAGCGTACAGCTACTTGGGTCTTTCTGGAGAAGTGATGCAAACAGAGAAGAACATGATCAAG
TACAGCATGTGCCAGCTGCCCAACTTTCTGCGAGGAGATGCCTTGGATCGGCTAAAGGAGAAATTTGAACGTGAGCGGGA
GCGAATTGGAGAAGATGAAGTCGGGAAAGGGATTGCCCTCCACAACCCGGCTTCTTCGCGACCGAAACGGTCATCCACTA
CAATGCGAAAAGAAGCTGCTCTGCACTCTTTAGCGAGGCAGCGGCCTGAGTCGATGTCCAAGGCAGCCGGCGCGTTTGCA
AAGGATCGGAGGCCTACATCTGACAATGCTGGAGACTTTGCGAACATGCAGACGACACCTGGCAATGGCAAAAGTGTCAA
ACCATCATCAAAGGCGGCTGCACAGTTTGGTTTCAGTCCGATGTTCTCGAATAACATGACTACGCCTCCTCGAGCCCAGA
GACCAGTCCATCCATTTGTAACGCCGAAGCACACCCGCATGTCAATGGATGGGAGGGAAGAACTAGACGAAGATAACATT
TTTCGCGAGTCGGTGCTTGAATGCATGTTCAAGGCAATTGGTCTCAATTCTACGTCCGCAACACCGCGGGAGGTTGAGTC
TACTGAGGCTTCGCCCCGACTCGTTTCGTATGACAGCATGCGTCAGAAAGCTGTCTTCAGCAACAATGCATTTGGCTTCA
TGGACCCATTCAATGGGTCTGCAGATGGTGATGCAGAGTCTATGACGTCAGGCGGTATGGCAGGCAGCCCTCCGAGCGTT
CAGAGTGTTGCCCGCGATATGGTTGGAGAGGTCGAAATTGTATTTTTCCCAAAAGGCTCGGTGCTGGTTGAGCAGGGTGA
ACGCAACCCAGGCCTCTACTATGTTATCGACGGATTTCTGGATATCTGCATCCCGGAGCGTGACGCATCGTCCCTGAGCA
TTTTTGACGCATCTCATAGCAAGGGACCGTCGGCGACAGCAACACCGCTGATGGATGATCCGTTCAACAATACGTTCGCG
ACTCCGAAGACACCGCAGAACGACGAGCCGAAAGGTTCGAGTGCTGGCGACGACGGGAAGAAGGGAGGCCGAGCGAGACG
AAGTGTGGCTCTGATAAAACCGGGCGGCCTGGCGGGATACATTGGCACGGTGTCGTCGTACCGGTCGTTTATCGACGTGG
TGGCGAAAACGGATGTGTACGTGGGATTCCTGCCTCGCACGTCACTGGAACGGATCGTCGACCGATATCCGATCGTGCTG
TTGACGATGGCAAAGCGGCTGACGCATATCTTGCCGCGGTTGATTCTGCACATCGACTTTGCGCTCGAGTGGCTTCAGGT
CAGCGCCGGGCAGGTAATCTTTCACCGAAATGAAGAAAGCGAGGCTATCTATATTGTGCTGAACGGCCGGCTGCGGCTGG
TGGACGAGCGAAAGGATGGAGGGATGGCCGTTCTGGCAGAGTACGGACAGGGCGACAGTGTTGGTGAGCTAGAGGTGCTC
ACGGAGACGGCTCGATCGGGAACGCTCCATGCCATCCGTGACACAGAGCTCGTCAAGTTCCCGCGTACGCTCTTCAACAG
TTTGGCGCAAGAGCATCCGAACATCACGATCAAAATCTCCAAGATCATAGCGTCCCGGATGAGGAACCTCATGGACAACC
CGGCAGCCACTCTGTCGCGGGATGGGTCGGTCATAACGACGACGGTGGGAAAGAGCGCATCGTCGACAGAGAACCTGAGG
ACTGTGGCGATTTTGCCCGTGACAGCCGGTGTCCCGGTTGTGGAGTTTGGAAACAAGCTGATGAGTGCGCTGAGCCAAGT
CGGAACGCCAAACGGGGCGACGTCACTGAACCAAGCAGCGATTATGAGCCACCTTGGGCGGCATGCTTTCAACCGGATGG
GCAAGCTAAAGCTGTCGCAATTTCTAGCAGACCTTGAGGAGAAGTACAGTCTCGTTGTCTATGTCGCTGGTACGTTTTAT
GCCTTTGCCTTCGCTTTCATTTTTTCTGCCGGCATTGAATGATGAGAAAAATCAGTTCCAGAGGCTTGCATCTGCAAGTT
GAGGATGGCAACGTTAACTCTAATTTTTTCCTGACTGCCTATCGCTATTTGTTGTCTATTTTACATGCATATTACTGCTG
CCTTGGGCGTCGAGAGACTAATGCTTTTCTCCAAACGCACAGATACGAATGTAAACTCGCCTTGGACCCAGACGTGTATC
ACGCAGGCAGACGCTATTTTGCTTGTCGGCCTTGCAGAGGACTCGCCTGTAATCGGCGAGTACGAGCGATTCATGCTGGG
GATGAAGTCGACTGCGCGAAAGGTTCTCGTTCTCTTGCACCCAGAGCGATACTCGTCTTCCGGCCTCACTCGAGCGTGGC
TGAAGAACCGGGTGTGGATCAATGGCGGGCATTTCCATGTGCAGATGGCATTCCGGTCGGAGTCGGTGCCAATACACCAA
GCACCGAAACGATTTGGTCCCAGCCTGAAGGAGAGGGTGCAGATCTTGCAAGCGGAAATTCAAAAGTACACGTCGCGCAA
GGTCCGACATGGTCCTTTCTATTCGCCAGATGCGCCACACAAAGGCGACTTTCAGCGACTTGCACGGCGATTGTGCGGCA
AGTCGATAGGGCTCGTTCTCGGCGGTGGCGGAGCGCGTGGTCTTGCACAGGTTGGTATCATCCGGGCGATGGAGGAAGCA
GGAATTCCGATCGACCTGATCGGCGGCACGTCCATTGGGGCATTTATTGGGGGGCTGTATGCGCGACACGCGGATGTGGT
GCCAATCTTTGGGCTGTCCAAGAAGTTTGCAGGCCGGATGGCGAGTATCTGGCGATTCGCTCTGGACTTGACATATCCGT
CAGCGTCTTACACGACCGGACACGAATTCAACCGGGGCATCTTCAAGACGTTTGGCAAGACACAGATCGAGGACTTCTGG
CTGGAATTCTACTGCAACACGACAAACATCAGCAAGAGCCGGATGGAAGTGCACACGAGCGGATATGCATGGCGGTATGT
GCGGGCATCGATGTCGCTGGCAGGCCTTGTGCCGCCGCTTTGCGACGAGGGCAGCATGCTGCTGGACGGGGGCTATGTGG
ACAACCTGACGGTGTCGCATATGAAGTCGCTAGGGGCGGACGTGATTTTTGCGGTAGACGTGGGGGCGCTGGACGATTCG
ACGCCACAGGCCTTTGGCGACACGTTGTCGGGGTTTTGGGCGTTTGTCAACCGGTGGAACCCGCTGTCTTCGACGCCGAA
CCCACCGACGCTGGCGGAGATCCAGGCGCGGCTCGCATACGTGTCGAGCGTGGATGCGCTGGAGCGGGCCAAGATGATGC
CGGGCTGCTTCTACATGCGGCCACCGATTGACGACTATGGGACGCTCGAGTTTGCCAAGTTTGACGAGATTGTCCAGGTG
GGATATCGGTTTGGGCAGGAGTTTTTGCAGAAGCTGGGGAACGAAGGGCGTTTGCCGCTGATGGTGGAGACGGAGGCGAA
GAAGGCGTTGCGGCGCACAACAGCGCCTCGGCGGGCAAGCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62