GenePrediction:GLEAN_167 Details

Name: GLEAN_167
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1129891..1131247 (+ strand)
Length: 1357
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1129891..1130830 (+ strand)
Length: 940
Type: CDS
Source: GLEAN
Position: GCSC_179:1130889..1131247 (+ strand)
Length: 359
>GLEAN_167 class=GenePrediction position=GCSC_179:1129891..1131247 (+ strand)
ATGGCAGGCGAGTCGTGGCTGGACATTCCAGCAGAGTCGGGCTTCTCGCTAGACAACATCCCCTTTGGCATCATCAGCCA
TGCCGGCAGCAAACAACCCCATGCGGCTGTGGCTATTGGCAGCCATGTCCTCGACTTGAAGCTCTTTTCTGACGGTGGAG
GCTTCTCTGGCCTGCCTGAGGCGGCACCCAAAATCCTGCAGAGCTTTTCTGAGACGACACTCAACTTCGCCGAGCTGGGG
CGTCCTCTGCACAACAAGGTGCGAGAGTACCTCGGCCTCGTCCTCGCCCTTGACACGCCCTTCGCCCGACTTTTGAGGGA
CAACGCCTCCCTTCGCAGTGCCAGCCTTGTTCCCCTGTCGCATGTCGAGACACACTTGCCGCTGAAAGTCGGCGATTACA
CCGACTTCTATGTCGGCAAAAACCACGCCTACAATGTTGGCGTCCTTTTCCGCGGCTCTGACAACGCGCTGCAGCCCAAT
TACTCACACCTGCCGGTCGGCTACCACGGAAGGGCTTCCTCGATTATTGTCTCGGGAACCCCCTTGCGGCGGCCCTGGGG
TCAGATTCTTGATGCCAGCAAAGCACCCATCCACCAACCCAGCAGGCGTCTCGACATCGAGCTCGAGCTGGGCGCTTTTG
TCTGCAGGAGCAACGCACTCGGCTCACCTGTGCCCATCACCGAAGCCGAGAAGTACATATTCGGCTACGTGCTGCTGAAT
GACTGGTCTGCTCGCGACATCCAGGCCTGGGAGTACGTCCCGCTCGGCCCGTTTAATGCCAAGAACTTTGCCAGCACCAT
CAGCGCCTGGGTCGTGCTGGCTGATGCGTTGGAGCCGTTCCGGACTGAGGGCATCAAGAACGACCACAAAGTGCTTCCCT
ATCTTCAAAATCCGACTACGCGCGGCGTTTTTGATATCAACCTGGAGGTCAGCCTGAACAGTAGGTCTCCTGTGCAAGCC
CTGTTGGGGGAGGTCTGCTTCGCTAATCCGCTGCGCAGCCGAGACATCCAGTGAGCCATCGGTTCTCACACGCTCCAATG
GAAAGTATCTGCTCTGGTCCTTCCCACAGATGGTCGTACACCACACGGCTGGAGGTTGTCCTCTGAACCCGGGTGACCTC
ATCGGTTCGGGCACAATCAGCGGGCCAGACAGCGGTACGCAGGGCAGCCTTCTCGAAATCACCAGTGGGGGCTCCAAGCC
CGTCATTCTCTCGGGAGGCGAGAGCCGCACGTTTCTTGCCGACGGCGATGAGGTCGTGTTTCGGGGATGGTGTGAACGCC
CTGGTATCGGCAGGGTTGGCTTCGGAGAGTGCAGAGGCCGTATTTTAGCGCCTTGGCCGTCTGGCTACAGCGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62