GenePrediction:GLEAN_1680 Details

Name: GLEAN_1680
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:443272..444900 (+ strand)
Length: 1629
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:443272..443429 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_144:443501..443731 (+ strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_144:443825..444108 (+ strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_144:444179..444900 (+ strand)
Length: 722
>GLEAN_1680 class=GenePrediction position=GCSC_144:443272..444900 (+ strand)
ATGTTCCTGCTAGCCATTCTTATTACGACATCCTGGAAGGATGGGACTCGGCTGGAAGCCCTGAACCAGCACTTTCTCAA
GGCGCTGAGCATCAAGCTGATTCAGAACGGAGACAGGGAACTGGACCTGCTGTGCGGGTTGCTGGTGTATCTCAATTGGT
AGGCCGCGATGTCGCCGATGTTTCATTCAGCTCTCTGGCAACTCCGACTGCTGATATCAGATGCTCTAGGATCCACCTGC
ACATGGCACCCAAAACTCATCAGGCGTACAGACTCACGGCCATCGCTATTTCTATGGCTGTTGACTATGGTATCACGCGT
CGGCCTGGCAAAGGCAGACATCAACAGCTGAACGTAGAGACCTTTAATGATTTGCCGCGAGGTCTGAATGTCGTTGACAC
GGAGTTCTGGGGGCTTGAGGCCCAGCGAGCGTACCTCGGCTGCTACCACATTGCAACATGGTAAGAAGACCAAGACTACG
ACCAAAGAAACCCCTCTCTAGGTGGGACTGTATGCATTTTGACCATGACGGCTTACAACTGCGCCTCGTATAGGTACTCT
ATCATCACACGCAAGACGATCCCGTTGGCCTATACCGAGTATCTGCACTTGTGTGCACAGTCGCTGGCTGCTACGCAGGA
AGTCCCAACGGACTCGGACCTCATCTTCCATCTTGAGCTCACTCGCGAGGCCGAGAAAGTGTACACGCTCTTCAACTACA
CCGAGACCAGCCAAGCACAATGCATGAACGATGAGCAGATTCAGATTTACCTGAACGCGTTCTGCGCCAAGCTTCATGAT
TGGCGATCACGCCTTCCAACGTTGCTGAAAGACGATCGTGAGCACTGCCAAACAGAGTCAGGCCGGCGTATCTACCTCTT
TTCAACAATTGCTGACAACATCGCTAGCTAGTCAGAGGGTGTGGCCCTCTCTCTTTGAGGCATTTGTACGTGAAGTGAGC
TTATCGGGCATGTCTCGGAGCACGGATATGTCTGTTTTCCGCATCCGCATTATCATGGATTCTTTAAAAAGCACAAAGGA
GTTTCTCGACACCTTTTTGGCTATCCCTCTTGCCGACTTGATAAGTCTACCATCCACGCATTGGGCCCTTCTGGGGTACT
CGATTCTGCTGGCTGCTACCATGTCTCTGTCGATCCAGACGCCCGGCTGGAACATCAAAATGGCACGCTCTATCATCAAG
CTCGACGCATATATCGATGCCTTGTCCGTTCACATCCACGACTTGTCTTCGAGAATACAAGTCTTGGAAACGGCCAAGGA
CTGGTATAAGAGTCTTTTGACAAGATGGGCCGCCATCAAGAGCAGCTATATTGCCACTCTTCACCAAACACAACCCGAGA
TGAATACCCCGGCCGCGGCTGCATCTTCGACCTCTGCTGCCGAGTCACAATTGACTCAGTACCCAGCCGAACAGCGAATG
GACATCCAGCAAGAACCCCCCCAATCGCCAGCTCCAGCTGATATTCGGCATGAAGCGCGCCCGCTGCCTATGAGCGACAG
CTTTCTCACCTCCGGTGGCGGGCTAGAGCTCTTTGACTTTACAGCGAATGTGGGCTCATGGATGGTCCCTGATTTTGACT
TTCCGTGGCTCGGAGTAGCTGGCTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62