GenePrediction:GLEAN_1689 Details

Name: GLEAN_1689
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:510209..512507 (+ strand)
Length: 2299
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:510209..510253 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_144:510306..510488 (+ strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_144:510540..512507 (+ strand)
Length: 1968
>GLEAN_1689 class=GenePrediction position=GCSC_144:510209..512507 (+ strand)
ATGGTCTTGCGAAGTCTAGTTTGGAAACAGGTCGTTTCTGCCCAGGTTCGTCTTCAACGTACCGTTAAGAAGCGACCGGC
TCTGACCTCGGCTACAGACATGCAAGAGATTCAGCGCTTCCGCCGCAAGCTCAGATGCAGCTTCGGATGTCCCGCCAAAG
AGGCCTCTCAGCAACCGGATTGTCGCCGGCCCCGGCTCTACTGGCGGCAAGTCTATCGATCCAACGACGTTTTACAAGTC
CATCTCGCACAGTGAGCGGCAAAAACGGTCGCAAGAACGGGTAAGAGAGACCACGAGCCTAGCTTGTGGCCACTGCTTAT
CGCTCTCATAGGACTTTCTGGTGTCCGTACTCTCCTCGTCGCCGACAAAACGGGACGCCAAGAAATACCTCCAGACCTTT
GGTGGCGACAATGTGTCCAAGGCGTTGAGCGTGTCGAAGAAGGCACCGCACCTCGAGCTGCAGCTCCGGCAACAAGCCCA
GGCCGACATGACAGAAGCAGACGGCTCGTACTATGCTGCCGACAGTATTCGCTCCGTCAGTAGCAGCCCGCGCTTTGTCC
AAGGACCGGAAAGGAGAAAGGTCCTCCTGCCAGTCGCGGCCGACCGACCGCACGTGGCCATCGTGAAGCTACAAGACCCC
GACAGCCTCGACGATGCCACTCTCGGCGAACTGGCCAAGACGTTTGTCCAGCTGCGGGCTCTGGGCCTCATCAGCGTCAT
CGTCGTCGGTCGGACTACGGCGGATGGCCATGCCCAGCACGGATGGCTTGACTACGTCACCCACGAGACCCTGCGTGTTG
CTGCTGCCATCGACCAGTACGGCGATCCGGTCACATCGCTGGTCGACTCGTCGGTGTCTATCGACGACAGTATGGTGGAG
ACGCAGCATCAGAATCTCAAAGGCTCTCCCTTTGTGCCCGGACAGGTATTCATCGACAGAGCGGAATCCCTGATGCGACC
GCTGCGAAATGGAGACATTGTCGTCATTCCTCCTTGCGCATACTCCACAAAGCAATGCGAGGCTAGACCCGTGGCCGCTG
ACGACATTGTCCTCGCACTGACTAAGTTCTTCTCCGGGATCCACCCGCAGCCAGACACTGCCGCTGATGCAAGCCAACTA
CACGGCAGGCAGCCGCAACCGCAAGGCACTGTGCCACGGACCGCAGCCGTCGTCGACCGGATCATCGTGATCGATCCTAT
AGGTGGAACGCCATCAAAACGCCGGCCGAACGGCGCCCATTTGTTCCTCAACCTGGAGGAAGAGTACCAGCAGGCCAAAC
TGGCCCTCGACAAAATGAGGCTGAGGGTGCCCAAGTCGACTGGCCGTGTTTCTTTGGAAGAAACAGTGTCGCCAAGAGAG
GTCGCCAGCCGGCACAAGGCCAACCTGGACATTGCCAGACAGGCCCTGGCACTTCTGCCCTCGTCTGCGTCTGCGCTGCT
GACCACACCCGCCGAGGCGGCCAACCTCGTCTCACCGGAACGAGATTCTGTCGATGATGCCGATGTCTTTGGCTACGTCG
GAAGCGTAGGAACCCGTCGCAGCCAAAACCCGCTCATTCACAATCTGCTCACCGACCGGCCTGTCTTCTCATCGTCTCTT
CCTCTGGGAAGAATCAAGCCCAAGACCAAGATACCCGCCAGCGGCGCCACGGGTGACAGCACGTTACCACGCATGGCCCA
GACGACGCTGGTCAAGCGTGGGATGCCCTTGACTGTTTTTCCGGACCCGCGCAAGACTCCCTGGAAACCCCCGGTTCCTG
GCGGACCCCGTCTTCGGCTCACGGACACATGCATCGACCTGCCGCGCTTAGTGCACCTCATCAACGACTCGTTCGATCGC
GAACTCGACGTGGAGCACTATCTTCGGCGCGTGGAAAACTCTCTGGCCGGCGTCATCATTGCCGGCGAGTACGAAGGTGG
TGCCATCCTCACGTGGGAGCGGCCAGCCGGCCTCGACGAGGAAACGGCCTTTCGAACAGGCCGGCTGGTGCCGTACCTGG
ACAAGTTTGCCGTCCTGAAAAAGAGCCAGGGCGCCGGCGGCGTGGCTGACATTGTGTTCACGTCCATGGTGCGAGACTGC
CTGCCCGACGGTGTTTGCTGGCGCAGTCGCAAGGACAACCCGGTCAACCGGTGGTACTTTGAGCGGTCGCGCGGCAGCTG
GAAGCTCGACGGCGTCAACTGGACCATGTTCTGGACAAGCCCGTGGGAGACTGTGGGTGAGAGGGGCATCTGGGACTACC
AATCCGTCTGCCGCAACATTGAGCCATCGTGGGCCGACAAGAAACACATATTGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62