GenePrediction:GLEAN_168 Details

Name: GLEAN_168
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1133831..1135286 (+ strand)
Length: 1456
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1133831..1133898 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_179:1133975..1135286 (+ strand)
Length: 1312
>GLEAN_168 class=GenePrediction position=GCSC_179:1133831..1135286 (+ strand)
ATGCCGTGGACCGAGTTTAGCTTCCCAGAGAAGTATGAGTACCAGAACGGCTTCGGCTCATATCACGAGTGAGTGATGGC
GGGCTGAGCTTGGAGAGGAGCCACAGGACATCGTGTCGACAGTCGAGCTGATTGATGGCAACAGGACCGAGGCCGTGACG
GGCGCGCTGCCGGTGGGTGCCAACTCGCCGCAACAGGCGCCGTACGGGTTGTACGCCGAAAAGTTGTCGGGCACGGCCTT
CACGGCGCCTCGGGCCAGCAACCTGCAGTCATGGCTGTACCGGATCCTGCCGTCGGCGGCCCACCGGCCGTTTGTGCTGT
CAACGAAGCAGCTGGCAAGCTTCAGCGCGCGCGGCGAGCCGCAGCTGACCAACGTGCCGAATCAGCTCCGATGGAACCCA
TTTGACATTGACGGCGAGTGCGACTTTCTGGGTGGCCTGCAGCTGGTTGGTGGTGCCGGCAGCGCGGCACTCAAGACCGG
TCTGGCCATCTATGTATACGGGGCCGGCCGCAGCATGGCGCCAGGTCACGCCTTTCACTCGGCCGACGGAGACCTGCTCC
TGGTGGCCCAGAAAGGCGTGCTCGACATTCGCACCGAGCTCGGTCATCTGCTCCTGCGGCCACATGAGATTGTCATCGTT
CCGCGCGGCATCCGCTTCCGCGTCGACCTGCCTGTCGGTTCCAGTCGCGGCTATGTCCTCGAGCTCTTCCAGGGCCACTT
CCAGCTGCCCGAGTTGGGGCCCATCGGTTCCAACGGGCTGGCCAACGCCCGCGACTTCCAGACACCCGTGGCTAGCTACG
AAGACGAGGATGCCAATGACAACAACAACATCAGCTGGACCATCACCGCCAAATTCGACGGTCGCCTCTTTGATGCCGCC
CAGGACCACACGCCCTTTGATGTCGTAGCCTGGCACGGAAATTACGCACCCTACAAGTACGACCTGGGCCGTTTTAACAC
CATTGGCAGCATCAGCTTCGACCATCCAGACCCCAGCATCTTCACCGTTCTGACGGCGCCAAGTCCTGTCGCCGGCACTG
CCGTCACCGACTTTGTCATTTTTCCGCCGCGCTGGCTTGTGGCCGAAGGCACCTTCCGCCCTCCCTGGTACCACCGCAAC
ACCATGTCCGAGTTTATGGGACTCATCTCTGGTGAGTACGATGCCAAGGCTGGCGGAAAAGGCGGCTTCCAGCCCGGCGG
CGCCTCGCTTCACAACGTCATGGGCTCGCACGGCCCGGACATCCAAACATTTGAACGCGCCTCATCTGCCACTCTAGCAC
CCCATAAGGTTGGCGCTGGCAGCATGGCGTTCATGTTCGAGAGCTCACTGATGCTTGGCGCCACTGACTGGGCCCTGACG
AACTGCGAAAAGGTCCAGGAGCTGTATAACGAGCACAGCTGGGGCAGCCTCATAAGGCACTTTACGCCTCCAGTATCCGA
GGCTCGCCGGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62