GenePrediction:GLEAN_1690 Details

Name: GLEAN_1690
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:512958..518101 (+ strand)
Length: 5144
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:512958..512989 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_144:513087..513168 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_144:513234..513316 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_144:513405..514005 (+ strand)
Length: 601
Type: CDS
Source: GLEAN
Position: GCSC_144:514056..514187 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_144:514256..514290 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_144:514650..514779 (+ strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_144:514841..514981 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_144:515059..515109 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_144:515180..515414 (+ strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_144:516091..516689 (+ strand)
Length: 599
Type: CDS
Source: GLEAN
Position: GCSC_144:516746..518101 (+ strand)
Length: 1356
>GLEAN_1690 class=GenePrediction position=GCSC_144:512958..518101 (+ strand)
ATGGACTTCAAGACCATTGGCAAGAGCTTTTCGTAAGGACCGCCAGTCCCCCCTCGCTTCGTGCCCTCCGTCTTGCTGCT
TCGTCACCGTTCTTTCTGCCATCTGACACGATGCGTCGTATCTTAATAGCAACCTGGGGGCACAGATCACCCCCTTCGCC
TCTCGGACGTTCCAGTACACCAAGGAGCAGCTGGGCCAGGCCGACGATAAGGTGCGCAAAGCAACGCTCAACAGGTCGCT
GTCTAGGTTTCTAATGTTGTTCGGCAAGCGAAACAGACTCAGATGCCACCTGACTACATCGATCTGGAGAAGCGCGTGGA
CGCCCTGAAGCAGGTGCACCAGAAGATGCTGGCCGTGACGTGAGCACACCACCTTCCGTCTCCCTCTTCTCCTTCTCGTC
AGCGTGTGAGCGCGGTTACTTACTGCGACTTCAATCCCCACTTGCAGTTCCCAGTACAGCCATGAGCCATACGACTACCC
GCCGAACATCAAGGAGACCTTCCAGGACCTCGGCCGCACAGTCAGCGAGAAGGTCAGCCTTCTGTCGTCTGCATCGTCGC
CTGCTGAGGCCCAGGCCGCCCTGACCGCCCCGACCGCGGCCAAGCCCCAGCCGAAGACGTTTGCGCACGCCATCGCGCGC
GCTTCCCTGGCCAGCAGCCAGACCCTGTACCAGCAGCACACCGGACCCAGCGAGGACCCGCTGGCCACGGCGCTCGAGAA
GTATGCCCTGGCCATGGAGCGCGTCGGCGAGGCGCGCCTGGCGCAGGATGCCCAGATCCAGAGCCAGTTCATTGCCGGCT
GGAACACGACGCTCAACACGAACCTCCAGTTTGCCTCGCGCGCCCGGAAGAGCGTCGAGAAGTCCCGCCTGTCGCTGGAC
GCCGTCAAGGCTCACGCCAAGGGCACCACCTGGAAGCTCCCGACGGCGCAGCGCGGCGAGCCGGTGCATGACGAGCAGGA
GCTGAACCCCGAAGCACAGGAGGAGATTGAGAAGGCCGAGGACGAGTTTGTCACGCAGACCGAGGAGGCCTTTGGCGTCA
TGAAGAATGTGCGTTGAAGATTTTTGCCGGCCTCATTACACCCCACTGACATCGGCAGGTCCTTGACACGCCCGAGCCGC
TGCGCAACCTGTCGGAGCTGATCGCTGCCCAGGCAGAATTCTACAAGAAGGCATACGAGACTTTGAGCGAGCTGGCACCC
ACCATTGAAGGTCTCCAGGTCGAGCAGGAGGTGAGAGTTCTCGGTGTTGCCCCTCGTCCTATCGCAGTATTCCAACAGCT
GACCGGGTTTTGTCACAGGCCACCTACCGGAAGAGCCGCGAGACCGCGCAATCGTAAGCAGTAGCATAGACACTTTCGCC
TCGCAGCCCACGAATAGCTACCGGGATAACAGCTGCCACTGTTTCTTTTTTGTCTATATGGTGAACACCTCTATACAATC
TAGTTCTTCCTCCGGAGGCAGGGCAGGCTTGACGCCTCTGGAGGATGGTGTTTCTTTGTATGCTATGCTTTCATCGTTGG
TTTCTATTGATGGTTGTTCCTCGTTCGGAATCTGCTCTATCACGGGGCTTCTGTGCAAAGCGTGTCCCTCCAAATGCAAC
CAATTCGAGACCCGTAGCTCCTAATTTGGTAGGTGGGGCTTAGCTAAAAGCTGTACTATGTAGCGACGTAATGCCCCAAC
GGTCAATCACAGCGCCACAAGACCACCGCCACAAAATCTGCATTCTGGCGCAAGTCGCGAAATTCAACTTGGGCCGTATT
CACAACGGACGGCGTCTAGGCTTTTGACATCCTGCGACAACAAGCCCGTCTCTGCGAAAATGGTGCGTTTTTCTTCCACA
CCCCCCGCGTCTCTCTCCGACTGCTGACACCTGCGTTTCTCAGTTACCCCTCGGCCTGCTTAGCGCCGCTCAGGGCCATC
CTATGCTGGTCGAGCTAAAGAACGGCGAGACGCTCAACGGCCACTTGGTGCAGTGCGACACCTGGATGAACCTTACGCTA
AAGGGTGTGGTGCAGACGAGTCCCGTACGTTCTACTGCTGCCGAGTGAGATAGCGAGAAGGAGCACTGGCGAGCGACAGC
CTGCTGACATTTCCACCTAAGGATGGCGATAGCTTTATGCGCATACCAGAAGTTTACGTGAAAGGCAACAACGTAAGACT
CGAGCGTTTGCACTTGGCTTTGCTCAGCTCGGAAAATATTCAGTGAGCTGACATGTAGCCAGATCAAATATCTTCGCGTT
CCCGACGAGATCATTGACGCTGTCAAGGAGCAACAGCAGCAGCAACAGCAGCAGCAACAGCAACAACACCACCACTATCA
CGGCCAGCAGTCTGGTTTCCGTGGAGGCCGCGGTGGACCAGGTGGAGGCTTCCGTGGAGACGGAAACGGACGGGGTGGTG
GGAACCGGGGCGACCGTGGCGATAGAAACGACCGCGGTGGCCGCGGAGGCTCCCGGGGTGGGCGGGGAAGAGGACGGGCA
CAATAGAAGAAGCGTGCATGGGACAGAAATAGACACTCCAGACACTCCTATGGGAGAACTAGGCTTGGCTGGCAAGAGCG
TGAACGACTTCTGTGCAGTGTCTTGGGCCGAGTTGCCAGCGTTGTTACAGCTGGTCGTCTGGCTGACATACCCCTTCTGT
CGCTCTGTCAGATGTATCAGAAAGGCGTTGTTTAACCGCGCCATGTGTTGTCGCACTTGGTCCAGGAAATATAGGGCGGG
ACCTGTTTCTGGGCAAAATGCATGAAAGGAATCGTCCTCACATATTCTCTTAGCCACGTACGGACAAGCTACCCGCGAAC
AGAGCTCATGTCCAGAAACTCACCACAATAAAGAGGGGCATTACAAGAAGTCTATCTGCTTTCGGGAATGACTGGACGCA
TGCAATGATGCCTGCATGTCTGTGCAGTGTAAGCTGTCAGTTCGATATCGGCGCCAGGCACGTGACTCTCAGTGTAGAAC
AATTTTTGTTGGCCGCAAAGCTTCTCAGCTACAGCCAGCTTAGCACAACCGCATCTGAAATTGGGAAAAGCGAGCACGAA
GGCAGGGAGCCCCAGAGCATACGTGCTGTATATTTTCCCCCATGTCGGGCAACCGCATTGTTGTGGACGGTCTGTGGAGA
TGTCTTTGTCCAGCCATCGACAAGGCCTCGCTTCTCCGGGTCATCAATGCACCTTCAATATGCCCGCGTCGGCGAAGCGG
AGCACGGACTTTCGCGGAGCGCCCGCCGCACGCCAATGAAACAGCCAAAGCTCTGTTGCCACGGCGCAACCGTCCAGCCG
GAGCCGTCCGGCAGGTGCACACGGATGCCCACGCGCGAGTTGGACGACTCAGTCTCGTCTCCCCGAATGGGAACGCCGAC
CAAGGGACGTACAAGCACGCCGGCCCCGACAGGGAAACGGATAACAGCAGGGCAGACCAGCTGCCGTGGGTGCGCTCGCT
GTTGGGGGCTCGGCCGCCGTACCGTCGCGAGCTCCAGTCGGCACCCACGCCGGCAATATATGCTGCTCTCCGGCAGCTAC
AGTATGCACCCGCAGCCTATAACCAGATACAGGCGTTTGTGCGCTTTCTTCTCGAAGACCGCCACGAGGTGCCGACAGCC
GTGCTCTACGAGGCCCTGGTGCGGGCCAACTGCCACACGACCGGTTCGGCCGATGCGGTGCGCGACGTGCTGCGAGCACT
GAAGGAGGCCCAGATCGAAGGCACGCCCAGCCTGTACCACGGTGCGCTGTCGGTATGACTGTTCTGGCTTGCTTTCTGTC
GACATGTCTCGCTAACCTACGACTGTAGGTCCTTGCCGTGCACCCCGACTACATGTTGCGAAACGCGGTTCTGCGGGAGA
TGAAGGACCGGTGGATCGATCTTGCACCTGAGGGCGTGCAGAGCGTGGCGCTTGGTCTGCTGCGGGACGGACAGTTTGAA
CGGGCCGTCGACCAGCTGGAGGCCATGACCGGTTCCGGAAGCGGCGGTATCGCCGTGCCGTCGTGGCTCTTTGACGTGTA
CATATACGTCCTCGGCCAAGAGGGCTTTCTGGACGACGCGTTGAAGATTGTCAACCACCGGCTTCTCAAGGAGGACGATA
GCGTGTCTCTGAACGTGTGGTACTTTCTGCTTGACGTGTGCTGTCGACAGAGTCACTACGGCGGCCTCGGCTACGTATGG
AGCCGAGCCGTGCGACCCGGCCGGCTGACACCTTCGGATGCCATGGGGCTAGAGGTCCTCAACATAGCCGCCCAGCACCA
GGATTCTGCCCTGGCCGCAGAGGTTATGCAGATGCTGTCGGCCCGCGGCACCAAGCTGGGCATGCCACACTTTGAGGCCA
TGCTGGACTGCTATGCGGCCGCCGGCAACACCAGCCTCGCTTTGCAGGCGCTCTGCATCATGCACAATGCCGGCATTGTC
CCCGACGAGGGCAGCACGCGGTCCATCTACCTGGGCCTGACCAGAGACGCTTCTCCGACACAGCCGGTCCTAGACGGTGC
CGTGGCCTCACTCTTCAACCTCAAGACCAAGTACGGCAGCGTGCCCATTGCCGCCTTCAACGTCGTCCTCGAGGCGATGC
TGCAAGGCGGCCGATCCGCCAACCAGGACCAGCAGCCAGCTGCCGACAACAACAGCATCGAAGCCGCGCTGGACCTGTAC
CGTCATGTCCGCCAGCTCTGCCCCGCTGGCCCTGACCGCAGCACGTTCCACCTGCTCTTCCGCGGCTGCTCGGACGTGCA
GCATCTCAACTTCTTGTTCTGCGAGATGCGCGCCTTCTCGCTTCTACCGGACGCCGGTATCATCAACCTGCTGGTGTACG
AAAACGCCGAGAACGGATCGCTGGACCTGGCCCTGAAGCACGTCTTCGACCTTATCGGCAGCAACAGCAGTGATAGCGAA
CTCGATGCTGCCGAGGCTAGGCTTCGCTCACGGCCATGGATCAGCCGCAAGGCCGCGACAGCCCTGGCAAAGCGGTGCAT
CGATGAAGAAGACACGCGCATCTGGGAGGTCGCCGAGGCCAGCAGGGTCCGCGGCCGGCCCATGGACGACATCCTTCGTG
GCATGCTTCAGGACATGCCCCGGGACAGATGGACTGCGTATGGAGTGCCACATGCGATCAGTCTCGAGATGGACGCACTT
GACGAGCTCTCCCTGAGCAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62