GenePrediction:GLEAN_1691 Details

Name: GLEAN_1691
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:519219..519865 (+ strand)
Length: 647
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:519219..519258 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_144:519354..519865 (+ strand)
Length: 512
>GLEAN_1691 class=GenePrediction position=GCSC_144:519219..519865 (+ strand)
ATGGTTCGGAAGTTGAAACATCACGAGCAGAAGCTCTTGCGTAAGACTATGTCCTCCGTCTGCTCTCTGTTTTTCCTTTT
GTTTTTCGTTTGACGGACTCTGGGCTTTGTAAAGCGCCGCGCTGACCCTCCACAGGCAAGGTCGACTTCACGACCTGGAA
GCAGGACAATGACCACCGGGCCTCAGCAGTCGTCCGTCGCTACATGATCCAGAAGCCGGAAGATTACCACTCATACAACC
GGATTTGCGGCTCGATTCGCCAGCTGGCGCACCGGATCAGCCTCCTGCCGCCCGACAACGCGGTACGCAAGCGCCACGAG
GACTTACTGATCGAAAAGCTCTTCGACATGGGCATCCTGTCCAACAAGGACAAGTTTTCGGGCGTTGAGCACCACGCGAC
AGTGTCGGCCTTTGCCCGACGGCGTCTGCCCGTAGTCATGACGCGGCTGCACATGGCGGACACGATCCAGGCGGCGACCG
TGATGATCGAGCAGGGCCACGTGCGTGTGGGCACGGAGACGGTGACGGACCCGGCATTCCTGGTGACGCGCAACCTTGAG
GACTTTGTCACCTGGACGGTCGGCAGCAAGATCAAGCGTCACATCATGCAGTACCGGGACGAGCTAGACGACTACGAGCT
GCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62