GenePrediction:GLEAN_1694 Details

Name: GLEAN_1694
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:528424..532767 (+ strand)
Length: 4344
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:528424..528676 (+ strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_144:528794..528939 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_144:529007..530155 (+ strand)
Length: 1149
Type: CDS
Source: GLEAN
Position: GCSC_144:530822..531385 (+ strand)
Length: 564
Type: CDS
Source: GLEAN
Position: GCSC_144:531455..531926 (+ strand)
Length: 472
Type: CDS
Source: GLEAN
Position: GCSC_144:531989..532767 (+ strand)
Length: 779
>GLEAN_1694 class=GenePrediction position=GCSC_144:528424..532767 (+ strand)
ATGAAGTACGGCCAGCAGCTGGAGACCGAATCTGTGCCGGAATGGAGCCTCCATAACATTGACTACAACACGCTCAAGGA
GTTTATCAAGATCCATACTACACGCGACCAGGCCACCGCCATCCCCATTCCTGGACAGCAGGACACTTCTCTCCAACGTT
TTGAACTTAACTTCTATGATGAACTATATCGCCAACATGACCGTGTCGGCCTTTTCGTCACCACAAAGGCAGATGAGATC
AACCGGCGACTACGTGCGCATTCTTTCCTCTTTTTTTCTTTCTTCTCCCTATAAGGCCTACCTTGCTAACCATGCGCAGG
GTACCTGACTGACCAGATAAGCCGACTGATTCTGTGCTGCAATTCGTCAGCTCGCGGCGCCACAACTTTCAAGCGTCAGC
GCCGCCTTGCAAAATACGAACGCACCGCAGCGCAGCTGAGCGACGAGACCCGGGACCTGGCCCGGTTCTCGAATGCCCAG
GTTGTCGCCTTCCGCAAGATCCTGAAGAAGTACAGAGTGAGCTACTTATCTGTGCCAACGGCAGCCTCTCCTCTTCATCT
TTGCATCGTCCTAATCAAGCCAGAAATGGACTGGTTCAAGCTCTCTTGGCACTCGTTTCCGCGAAAACGTGCTCTCTGAT
CCCAAGAGCTTCACCAAGCGAGACTTCTCCCACCTTCAGAGCCAATGCGACGAGCTTCTCAACACCATCCGAGCCACCAC
TCCCCTCACCTCCTCACCCACATCCAACAGCCGACCGCCCACGCCAAGCAGACAACATCGGCGCAGCAGCCAGGTTCATT
CGTCTTCCTCCTCCACGCTGCAGGCGCTTTCTTCGTCGGTCGGGTCTGAGCAAATACATATACCACGCGGTCCAAAGACT
CTCACCACTGCCCCCGTGCAGACGCACTACTGGAACGAGTACGATGATGGGAGCGAGTCGGGCGAAGTTGGTGGAGCTGG
AAGTGGCGGCTACGCCATATATCTGCACCCCGATGATGAGTCGGAGTTCCCGGGTGTGGCAACGCTCGTGTCCTTTTTCA
CGGTTCCCATCGAGAAGGCCAAGAAGTGGATGAACGCCCGGGGAGCTGCGGTTGCGCATCTGCCTGACAACGGTAGCGAG
CACTCGCCACTGCTGTCTCACAGCGGCGTCAACTACGGAGCCGGCAGCACTCTGTATGCCGACGAGTCAGCGTCGCAAAG
ACGGCTGCGACGACAGAATGGCAAGACGCCCGGCCGTGCCGGAATGGCCGCTATGGGCTCGGGGCATTACGACGACGTTA
GCCATTACGGCGACGACGACGACGGCGAAGACGGGGACAGCGCCGGTGAGGAGGGCGAAGACGACATGTTTGCCAGTGAA
CACGAGTTCCCTCAGGGGTATGAGACCTACTACGCAACGCTGCCGTCCGTCGCCGACCAGCGCATGGCCCGCTATCGTGA
GACGATCCTGCTTCGCGGCGCATTCGGCTGCTTTGCTGCTGCTGCTGTGCTGCTGGCTGTAACCGGCATCTTGATCAGCA
CGGGTCGGCATCGGCTACGCGTCGAGGTTGACGCTGGCGTGATTATGGGTGTCGTGGCCAGCCTGGGCTTCGCCTGCGCA
GCACTGGGCATGGTCATGGCAAAGAGCGAACGAACCACGCTTGCAACAGGCCTGCTGGTCTGGACGACGTTTGGCGCTAT
CTGCGTCCTCAACGGCGTTGTGCTGCTGTTTGTGATGGGAAACACCGTCAGGGTATGAGACACGGTATAGATGGACCAGA
CGGCACAGATAGAAGGCTATCTCTCTCCTGGTAATTGAGCTTCGTTTTCCTTGGGTGTTAGACTGTGTGTGCACACCGGA
TCTTGCCCGTGGTCTTCACCCTTTCTTTTGTCTGCTTTGTTATCATACGTCCTGCCTTGTTTTAGAAATTTGTATAGCAT
AGTACCCCAGCATAGACAGCACAGCGCACTGGTATATATAGTGTGGGAGCGGGTGCGTTACAATGATGAGTTTACGGCTG
TCCAGTCTTTTTAGTATACTTCTACTAGCCCTTTTGACAATTGTGTGAATTGACTCCGTAGCATTGTCAACAAGTGGTCG
GCTAGAAGAGGTGAGTGCGTAATTTGTCGGACCTCGAGACAAGACTTCTGAAGTGAGTTAATACTTCCTACAAGGCCATA
TCGTGGATGGCATACTCAAACAAACCGCCAGACCAAACAAGGTCACAGATTGATTGTCCTGCGAAGAAATCTCTTATCAG
CACCAGTCGACAGCGTCCCTCGCACCTTCCCAGGTTGGCTCCACTTGATTCGCTTCCAAATGGCCGGTATGCCCTCTAGT
GTTCACCGAAATAGCGAATTCTTCGAAGATCCGATAATTTGAGGAGAGGAAAGACGCGCCAACTCTACAATCCTACAGGC
AACAGGCGATGTAATGATTGGAAGCCCAAATTACGCGACCATTGCTCAACGCACGCTCACCATGGCATCGGCGTCTCGTC
AGCCGCGCGAGATGCCGAGGTCTTTATCGAGTCTTGCACTGCTGGTAGCCGCTGCAGCCTTGGCATTGGCTGTGGCCTAC
TTTCGTGACAGTGTTAATTTTGGCACGTCTTTGCAGTCAGCAGCAAGCGCACCGCAGACGTACTGCTACGAGGGAATCAA
GACTCTGGCCGAGGACCAGCCGTCGGCGCGGTGCTTCAGTGTCGTGGACGGGCACTTTACAGAAGTTTTCACTCCCGAGA
ACGAGCTGGACAGTCCGAGCCTCTCTGGATATGTTATTCCAGGTCTCTGGGACGGCCATGGACATCTCATCCAATATGGG
GAATTTCTTCAGTCGGTCGACCTGTTTGGGTCCACGGCAGCCAAAGACATCAGAAAGCGCCTCCTAGATTACATCGGCAC
GCACCAGGGCATAGGCTCCAAGGACCAATGGCTACGAGGCTTTGGATGGGACCAGATGGCCATGGGTGGTATGCCCACTG
CTGTGAGTCTCGAGTCCGGGCGTGCTTTCTGCTCCTTTGACGCCTGTCTGCCCGCTGACTATGATCGCTAGGCTCTGCTG
GAAAGCGACGAGAAGCTCAAGGGCCTCTACGTGATGCTAGACCGTATTGACGGTCATTGCATCTGGGTGTCCCAGGCCGT
CCTCGATCTCCTTCCCGCCCAAATTCCCGACGTGCCCGGTGGCGAGATCATACGCGACCCTGGCATGGGCGTGTTTTGTG
ACAACGCCATGGACCTGATCATGTCTCTGTGGCCGCGACCAGGCCGAGAAGTCAAGGCCACATACATCAGGACAGCAATG
CAGAAGCTGAGCTCTCTGGGCCTGGTTGGCATGCACGACGCCGGAGTGATTCCCGAGGACCTGCAGCTGTACCGGGAGCT
GGCTGACACAGAGGGCTGGACGATCCGCGTGAACGCTATGATCGAGTGCAAGGAGCGCAACACGTTCTGCCCCAACGAGG
CGGTCGGGCTGCGACAGACGACGAGCGAGTTCCTGACCATTCACGGTGTCAAGCTGTTTGCCGGTAAGCCCACGTCACCG
ACTGCGACCGGCCTTGTGCCCTTACTGACAGATGGCGAACCACAGACGGGGCGCTGGGAAGCTGGGGCAGCGCCATGATC
GATCCCTACAGTGACCGGCCGGACATGTCGGGCTCGTTGCTGGTGAACGGCTCGACACTCCTGTCGCTGACGCGAGACTG
GTCGGAGGCGGGCTTCCAGGTGAACATCCACGCCATTGGAGATCTGGCGAACCGCTACGCCATCGACGCCTTGGAGACGG
CGCTGGTCGATCTCTGTCCTTCACGGCCGCCGGCCGAGTGCCAGCATGAGCATCGCTTCCGTATCGAACACGCTCAGATC
ATCCACCCCCATGACCAGGCTCGGCTGCACTCTCTCGCGCTCATCCCGTCAATCCAGCCAACGCACGCCACGTCGGACAT
GAAGTACGCCGAGCTGCGGCTGGGCTCCAAGCGGACGCGGGAGGAGGCGTACCGGATGAAAACGCTGCTGCGCAACCGGC
CCATCCTAGGCAGCGATTTCCCCATTGAGCCGCCAGATCCGTTCCAGGGCATATACGCCGCCGTGGTCCGGCGCAGTCCG
CACACGGGGAAGAATGCGGACGGGACGAACGATCCCTGGTACCCCGACGAAGCGCTAACGCTGGACGAGGCGCTGCTGGG
TTTCACGCAGGGGCCGGCGTACGGGGCCTTCCTCGAAGAACTGGCAGGCGTCATCCAGGTGGGCGCCTTTGCCGATTGGG
TCGTACTGGACAAGCCGATCAGCAGCTTCGACCTGGAGGACTTCCGCGACATGAAGGTCAGGGAGACCTGGGTTGGCGGA
AAGCTGTCCTACAAGAGGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62