GenePrediction:GLEAN_1696 Details

Name: GLEAN_1696
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:541707..544324 (+ strand)
Length: 2618
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:541707..542031 (+ strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_144:542085..543346 (+ strand)
Length: 1262
Type: CDS
Source: GLEAN
Position: GCSC_144:543737..544324 (+ strand)
Length: 588
>GLEAN_1696 class=GenePrediction position=GCSC_144:541707..544324 (+ strand)
ATGCAGCGCGTCTCAAGTCTGCTCCCGCTCTGGGAGAGGGCAAAGCCAGTCGACAGCACTGGAGACGGCGCTGCGAAGAG
GGCCAGCAGCAACACCATCCCTACTGCCAGCAAGGCCAACCGACCATCGAAGAAATTCAGCTGGGCTGACCGTATTGGTC
TCGGCCGGAGCCTGAGTGTGTCCCCGGCCACTGCCAGTACCGGCTCCATGAGGCCCGTGTCTGTTTCTGTCACGGTGCCT
AGACAAATGGGACGGGAGGCTTATTGGCCGACAACTCTCGACCATGAGTGTGAAAAGGCGGCTCGCATCCTCAAATCATT
CTGCAGTAGGCTTCATCCCCCTTCCAACATACCTTTTCCCTCTCCCTGACGCTCTCAGCCGATGGCTTCCTCGACGAAGC
GGTCGATTCTATACCCACCAGCCCGACAAGTCGATCAAGCATCACCAGCCTCTCATCCCCGCGGTTTCCGTCTCGACGCT
CAAACGACGCACCTCCAACTTCGCCCACAACCTCAGTTAGCACCGTGAAAAAGAAGATCCCACCCCGAGTTGTCCAGGAA
GCCGTTGGTCTGGCTATTTTCTCATGCATGCGCTCCGGCCTGTGGATGTCTGGCTCTGGAGGCTCCGGCATTCTCATTGC
CCGCAAGGCTGATGGCACATGGTCTCCGCCTTCGGGAATCATGTTGCATACCTCGACCCTTGCCTTTGTTATCGGTGTGG
ACATTTACGACTGCGTTCTCATCATTAACAGCGTCACCGCCCTCGAGATGTTTACACGCCCACGCCTCACACTCGGCGCT
GATGTGCCTTTGACCGTTGGGCCCCTGACCACGGTCGGCCTACTGGAGAATGATTTTCGATGGAATAACGAAATGGGAAA
TACAGTATTGACCTACTTGAAGGCCCGAGGCCGCTACCGTCCTGCGCAGTTACACGGCTCGCTCGTCACCGAGCGCTCCA
ACGAGAATGAGCGGTTCTACTCAGAAGACAACACCAGTGGCGGCACTGAACCTATCGACGTTCTGGACATATTAGCTGGT
AACATTGGCAAATCGGTCCCCGAAATCGTGCCCCTATTCGAAGCTATCAAGGCCGCTGAGGGCCGTTCAGACTTCGACGC
GGCCATTATGGAACAGCTGTCTATGCAACCTGCGCCTGGAGACGCCGATATTGTCGACACGCCCGCGCTGTTACCTCCAA
CTTCGCCCAAAGCGTCCAACTTTGGACTGCTCGACGCTGCTGACCCCGACCCCTTTGGCATTATCGCCCTGGAGATGGCT
GGCCTGGAGATCCGTGAAGCCGGTTCCAAGCACCGGCCCTCAAGCAACCAGTTTGACTACACAGCAAGCCCAACGAGCCC
CACCTTTACCCATTTCAACCGTCAAAGTGCGGACGCCACGCTCGAGCATGGAAGCCGGGCCAGCTACATGTCTACTCGTA
CGCAAGCCACGTCTATGAACGATGCGTGCACGCAGACCGACGTGGCAGAAACTCCAGACACATCGTTCAGTCCTACCCAC
TCTGACGATGGCAAGGACGGGCACGCTTCAACGACATCAGAAAAGGTCTCCTCACCAGTGCCAGAATTGGCGCTGCGAAA
CTCGCCTGTTGCACTGGCGACGGCAAGCAGGGAAAGCCGCGTTCTGGCAACATCTGTTCTGCCGAGTGCGGGCAATGGCC
GGCCGATAAGCAAAGTGATCTTGACGGTTGACGCTGGCATGAATACGCTGGAGCAGACTGATGGTGATAACGATGCGGCA
TCCCAATACTATGTTGCCGACGATCGCGACGCGGATGCAGACGACGAGGATGAAGAGACTGACGGTCTCGGCGACTGTGA
CGAGACCATCATCTCTGGCGTTGACGGCGCCGATGATGCAGAGGACGACGATGCCGACGATGTCGAGGATGACGAGGACG
ACGACGAGGACGACGACGTGGAGGACGAGGAGGATGAGGAGCCTGTGATTTTTGAAGTGGCCACCACCGCTGCTCGGCCT
GTTCGAGCTGTGCCAACCACGGGTGCTCAGATTATCCAAGCAAAGGGCTCACTGGTGACTATTCCAAAACGGATTCCTCC
GCCGCTGCCGCTGCGAAGCCCAGCTAGAAGATCTCGGGCTGGCATAAGCGATTTCGGCGATATGTCTGCTACCAACACCC
CTTTCCGCCAGTCGTTCCAAAGCACATCTGCGCTCCTTACGCCGTCTGCGCAACCAGAAGCGGAGACGACGGAAGCACCG
ACAGCGCGGTCTGTCGAAATTGCTGCTTCAACACTTCCGACAGAAACAACAGCTTCTGCTGTTACCCTACCCGAGTTCAT
TAGCGCCGAGAAGGCCGTTCCTACACCCTCGCCCTCATCCACAGTCGTTGAGTTTAGTGCTACTGTGGCGAAGGAGGCAA
AGAAGGAAGACAGCGTCGACTCTTCACCAATGTCAAGGACGACGGAGTTCACCGCGTCTTCGGTCGACGACTCTGACCGA
GAGCCACGTACGCCACGCCTTGACGAGCACAGCGCAGTGGCCGAATGCGGCAGCCTCAGTGCTGTGAAGCCTGAGGAAGA
CTTGGAAGGAGAGGCACAGATGGGCCCTCCCAACTCGTCCACGATCACTGTGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62