GenePrediction:GLEAN_1697 Details

Name: GLEAN_1697
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:551506..552023 (+ strand)
Length: 518
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:551506..551620 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_144:551690..551924 (+ strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_144:552005..552023 (+ strand)
Length: 19
>GLEAN_1697 class=GenePrediction position=GCSC_144:551506..552023 (+ strand)
ATGGCTTCCCTGGGATCATTGGTGTTCTGCACCGACTGCGGAAACCTTCTGCCCATGTCAAAGGGTTCCGATCGCAACAG
GCTCGTCTGCCGCTGCTGCGGCGCTCACAACCAGGGTATGTCTTCTTGCGGCAGGAAATAGAAGATGGCACATGGGCAGA
AAGGCCGAGATGCTGACCCTGCAGACCAATCGGCGTCGCAGACGATTGTCACCAGCTCCAACCCAAAGGACTTTCCGTCG
CCATTGCGCCAGAAGCTGTCGACAACGCAGTCAGTTGAGCGCCACAAGGTGTCGACTGAGGCTGTAACCACAGAGACTTG
CCCCAAGTGCGGTCGGACCGAAGTGCGGTTTACGACGGCGCAAATTCGCAGCGCTGACGAAGGCTCCACGGTCTTCTTCC
ACTGCGACTGTGGTCACAGGTGTGTTTCTTCCTGCTATGCGGCCAGCAGGCGCCCGCGCTGGATGGCATGGTCTTTGCTG
ACGTGCCGCTCTCTTACAGATGGTCTGAAAACAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62