GenePrediction:GLEAN_1699 Details

Name: GLEAN_1699
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:562677..564540 (+ strand)
Length: 1864
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:562677..562869 (+ strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_144:562935..563104 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_144:563252..563746 (+ strand)
Length: 495
Type: CDS
Source: GLEAN
Position: GCSC_144:563816..564122 (+ strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_144:564191..564540 (+ strand)
Length: 350
>GLEAN_1699 class=GenePrediction position=GCSC_144:562677..564540 (+ strand)
ATGCCCGAAATCGTGGCAAGCCAAACACCACCGATTTTGCACGGCCCTTCGGAAAAGGAGAGGAAATATGACCGACAGCT
CCGTCTTTGGGCAGCGAGCGGCCAAGAAGCGCTTGAGGCGGCCAACATCCTGGTTGTGAACTCGGGCTGTGGTACTGTTG
CTACGGAGACACTCAAGAACCTTATCCTTCCTGGTAGGCTGCGCAGTTCCCGGTTTGTTCTGTTGTTGCTTCGAAGCGGG
CTAACGTCTCTTTCAAAGGCATCGGAAAGTTCACAATCTTCGATAAAGCTACAGTCCAGGAAGAGGATCTTGGGGTCAAC
TTTTTCCTAGAAGAAGCTAGCCTTGGAAAGTCAAGAGCCCAATGCTGCACAGAGCTCCTTCTCGAGCTCAACCCCGAAGT
ACAGGGCGACTGGTACCCCAAGCCAGAGGTGTGTGTGCTCTAGTTGAGCTCTCGGAATGGGAGAGTATGCGAAGAAATCT
TTACTGATCAGCTTTAGTCCGCTTCCGATCTTGCGGTGCTACTTGATACATCGCCCACCTACACAATGATTGTGTATACA
CATCCCATACCCCAGAAAGACCTCACACTCATTGAAGAATACGGGAAACAGCACAAGACTCCACTGCTGGCAGTGCATTC
GGCTGGCTTCTACTCATACTTCCGAATTTGCTTGCTCGAGCCTTTCCCGGTCGTCGACACGCACCCGGACGAAACTGCAA
CAACAGATCTCCGGTTGCTAGCACCCTGGTCCGAGCTGGAAGCTTTTTCACAGGAGCTCGCGGCTAATATCGACACGCTG
GATGACCATGCACACGGTCACTTGCCATATATTGTGATCCTGCTGCATTACCTAGAGCGCTGGCGTAAGGCACACGACGG
CAAAAATCCGGTCACATACAAAGAGAAGGTTGCTTTTAGGCAAACGGTGGCAGACGGTGCAAGAAAAAACATTCCAGAGG
GGGCAGAGGAGAACTTTGAGGAAGCAGTCAGCGCCGTTCTCAGGAACGTAGAGAAGCCGACCATCCCATCAAGTGTTCGA
GAAGTATTCGCACACGATCTACAAGACTCAGTAAACCTCTCCTCCCTCTCTTCTCTTTTCGTAGCTCCAGTTCAGTGTTC
TGACTTGTCATCCATTCAGGAACTCCGTTCAGGATTCTGGGCTATTGCCCGTGCAGTCAAACAGTTCTACGAGAAGCATG
GCGCCTTGCCACTGCCCGGAAAGGTCCCCGATATGAAGGCCCAGTCCAAAGTGTACATCCAGCTTCAGACGATTTACAAA
AACAAGGCCCGGAAAGACGCAGCCGAGGTACTTGCCACTGTACGAGAGCTTCCAGGTGGCAAAAATGTCGACCCTGCAGA
GGTCGAGCTGTTCTGCAAGAACGCCGCCTTTATCAAGCTTATCAATGCGACAGAGACAAGTGCAGATCGCTTGTCCAAGG
TTACCGGTACGTTCTAGGTGCCGCCGCCCCCATTTCTTCAAGATCAAATAACTTATGCCTTTGCTTCGCTACAGAGGAGG
AGTTTGCCAAGGATGAGAATGCTGAGATCCTAATGGCTCCTCTGTCGTTGGCACCAATTTATCTAGCACTTTATGCTACG
GCACACGCGCCTGAGGCGACGTCCGATGAAATATTGAAGAGCATTGATCAACTTGTACCAAAGGCTAGCCAGAATGAACG
GGTCGTCATGGTTGCGGAGGAATTAGCCCGCGCCAAGGGTGGCGAGCTCCACAACATATCAGCCCTGACAGGTGGTATGG
TGGCACAGGAGATCATCAAAATCATAACGAGGCAGTACATCCCTATCGACAACACCTGCATTTTCGACGGTATCAGCAGC
CGATGCCAAATACTTCGTCTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62