GenePrediction:GLEAN_169 Details

Name: GLEAN_169
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1136020..1137919 (+ strand)
Length: 1900
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1136020..1136580 (+ strand)
Length: 561
Type: CDS
Source: GLEAN
Position: GCSC_179:1136660..1137734 (+ strand)
Length: 1075
Type: CDS
Source: GLEAN
Position: GCSC_179:1137819..1137919 (+ strand)
Length: 101
>GLEAN_169 class=GenePrediction position=GCSC_179:1136020..1137919 (+ strand)
ATGTCAGATGATGGCTCTTTCAATACAGGCCAGCGAAAGGCGGTATCTTCCAAAATCACTCCGGCATATGAGTTGGCTAA
CTCAGATCACTATCTGGGCGTCGCACGACGGCACCTGACCGCCTCAATTTCCGAGCACGAGAAGATACGACAGTTTTCTT
GTAGTCCGGCCGTCGACGGGCCAAAGGAGCTTCAGAAACTCGTCAACCACCGTCTCCACGGCTCCCCCGGTGGTGTTCTG
GCAGCTCTAAGTGAAGAATGCTGGGCTGATATCCTTTACACCTACGACGAGGAGATCGGCCTCCAGTATCCTTTCCTCGA
TATAGCTGACCTACAGAGGGACATCAGCCAGGCAGTTCACCAGAGGGCAGACGGATACTTTTCCCAGCACGATCAAATAT
CCGACATTGCCACGCTCATCCTCGCCGTCGTCGCCATCTTCACCGATTCTGACTCGGCAGAAATATCCAACGCCTTGGTG
CAGAACATATTTACGGATGCCATTGCAAGAACACATCTCGCCGGCGGCGACAGGCAAAGCCTTTCCTTGCTGACCCTCAC
AGTATGTCTGTCCGCCATCCCATACGTCTTTTTGACCGAGTCTCCTCGTCGCTACTAATTACCATGTCCAACACCATCAG
AGCATTTACTTCTTCCTGACCGACAGAGAGATTCTAGCTTGGAGGGGCATCGGTACTGTTTCGCGGCTGCTTCAAGAGCT
TCGGGGCCACAGAAACGACGATCTGCCACATATGGCAACGTCGGCCTCTCCCAAAGCGGACGACAATGTGAGCGAGAAGA
TGTACTGGACTGTCTACACCCTGGACCGGCGGTGGAGCTTTGGCACCGGTCTGCCCTTTTCTATTCAGGATACAGACGTC
CGCCACTATCCCCAGTTCTCGGACGACTCGCTGTCCGCTCTCTACCTGGAGCACATGGTGATATACTGCGGCATCACGTC
CGAGGTACGCCGGTGGTGTCTTGATGCTCCCCTGGCTGCAGCCGCCACGGCAAACTCTATGTGCGACCTCCTCTGCTTCC
GCGTGATCATGTGGCAGCGTAACTTGCCCGCAAAGCTGCAGTTTCGCGGCCTCCAGGACGCATTCGATGCGGCCAAGGAG
AGCCGTGGCACTTACAAGATCCGCCTGACCCTCTATCTGCGCGCAAACCAGATGCGCACTGTCATCTACCGCAAAGCGGC
TGTGCGGCCCGGCACAAGGGATTTTGACCCCTCTCACGCCAACATCATGGCTGCCACCGCACAAGACACCGTCCGCATCC
TTGATAGCCTCGCGCGCAGCACTAACATCTACCAGACGCAGCAGAAGACTTTTAACCACTTCCTCGAGACCGCCCTTTCG
TCCCTGCTACTGGTTCTTTGTTGTTCTGTTGACCCCGAAAATCGTTCCTGTTTGGATGAGGTGTTTACCGCCTTGGAGCT
GGTCCGCCAGCTCTCCACAAGATCATCTGTCTCACGGCGACTACAGGACAAGCTGCAGACGTTCCAAGCCGTCGTGACCA
GTCTGCAAGCCGAGATGCAACACGCCGGAACCGTCGACATTAGCTGTGGCAGTGCAAACGCTTCACCAGGGCCGACAGCC
TCTGCATCTGTGTCTGGAGACCTCGATCCCGTCGCCTCTTTTCGTGGACCGCTTGCCAACGGCTTTTCCGTCCCGGTCCA
GCCCGTCTTGCCCCTGCAAACGACAGCAGCATGTTGTACGCTGCCAACTGTCTCCGCTGGCATAGAAACCCCGTCACCAA
TAGTACCAGCGAACATGACTTTGCCGTTGCACTTTGTAGGCAGCTCGTCAGCGGACTGCGAGACTAGCAATGTCCCTCTC
TTTCGATGTCCAGAGTTGACCGACTACCTGATGGGATTCAACAGTAGCCTTTTTATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62