GenePrediction:GLEAN_1700 Details

Name: GLEAN_1700
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:566947..568721 (+ strand)
Length: 1775
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:566947..567368 (+ strand)
Length: 422
Type: CDS
Source: GLEAN
Position: GCSC_144:567440..568721 (+ strand)
Length: 1282
>GLEAN_1700 class=GenePrediction position=GCSC_144:566947..568721 (+ strand)
ATGCTTGACTCCTCTATCGTTGCCACCAGCCTTCTGACCATCGGGGAAGAACTGGGTTATGTGAAACTTCTCAATTGGGT
TGCTCTGGCATACACGCTGGCGTACCTAGGATGTGCAGTTATCTTTGCACGCTCTTCTGACGTGATCGGCCGCCGCAATG
CGTATCTGGTCGCCTTTGTCATTTTTCTCGCCTTCTCTCTCGGCAGCGGATTCTCTCGAACGATGTACCAGCTCATCACC
TTCCGCACTCTCCAGGGTATCGGCGGGTCTGGGCTGTATTCGCTGTCCATGACTATCTGGCCTGAAGTTGCACCTTCACA
TCTGCAGCAGCACATTGCCAGCTTAGCAGGAGTCGTCATCGCTGTGGCGGGCGTGCTGGGCCCTGTCCTTGGCGGAATAC
TTACACACTATGCGTCATGGAGGTGGATCTTCTGGAGCAAGCAAGTCAACTGTCTCCCACTTTCTGGCCTGTCGCCCGCT
GACCTGTTTACAGCGGTCCTATTGCAGCTGTCGCCATCGTTGTCTTTCTTTTGTCATGGCCCAAAGCAGAAACTTTGCCA
CCGGTCCAGCTTCGCCCATGGAGAGAGCTTGATTTCGTCGGCTCATTTTTGCTCATTGCCGCTGCTGTGCTCGTTACATA
TGCATTTCAGAACTCCAGTGCAGACGGTTTGCATTGGGGACATGCCCTTTTCTTGGCGCCGCTCATCACGGGAGTCTTTT
GCTGGGTAGCGCTTTTCGTCTGGGAGTGGAGCATCGAGAGGCGGAGAGCACACATATTGGCTGCGTTTCCTATGAAGCTC
ATTCGGAATCGCGTTTATTTATCGGCTCTGATTCACACCATGTTCACTGGATTTCCCTTCTTCACTGTCGTCTATGTTTT
CCCCCTGCGTCTTCAAGTTGTCAATGGTAAGAGTGCCCTCATTGCCGGCGTCATGTTACTGCCCATGCTAGGAGGTGTTT
CGATTGGCAGCTATGTGTCTGGTGCTATTAACGCGCGATCAAACCGAGTGTTTGAGATCTTGGTGGTCTCCAGCTGCCTT
TTGACTCTCGGCTGTGGCTTGGAGACCACCCTCTCTGCTTCGGTCTCTCTCCCAGCCAAGGCGCTTGGGTTCCTGCCCTT
TATTGGGCTCGGCGTCGGACTTGCAGCGGCAGCATCAACCATCGTGGCCAGTTCCGAGGCGCCGGAAGGCGAGCATGCTC
CCTCACAGGGAATTTTAGCCCAGATCCGTGTTTTTGGTGGCAGCATTGGCATCGCCGCATCTTCAGCCGTGCTCGCCGCG
CAGGAGGTGAAAAGGGTGGACTCCATGCGATTCACGAGTGCAGGAGCTCCAATATCAACACAGGACTCCCCGGAGGCAGT
CTTGATTCGCGAGATCTATTCAGATGCATTCAGAGGAGACATGCGCGTTTGCATAGTCATATCGGCAGTCAGTATCGTTG
CCGCCTGTGGCACCTACCGACGAAATCGGAAACCAATATTCTCTTCAAGCCGCTTAGCAGAAGATGGATCGAATGGAGAC
GAAGAGAAGACAAAGAGTTGTGGAGGATCGGATACAGAAAGATCACAGCAAGGCTCGGACGAAGCTGCCTCGGATACACA
AGTTACGCAGCTTTCTAAGTCGGAAGACAAGCAAGAGGACAAAGAGATCGGCTCAGCCGAGCAACCAGAGTTGGCCAAAC
ACAGCGAGCATTCGGATCAAGCCGCCCTAAACAGAGAGGCTAGGGAAAACAGTTCGGCACGTGCTAGTGGACACTCTGGA
GCAATTGTGAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62