GenePrediction:GLEAN_1701 Details

Name: GLEAN_1701
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:569383..570389 (+ strand)
Length: 1007
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:569383..569708 (+ strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_144:569760..570125 (+ strand)
Length: 366
Type: CDS
Source: GLEAN
Position: GCSC_144:570193..570301 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_144:570354..570389 (+ strand)
Length: 36
>GLEAN_1701 class=GenePrediction position=GCSC_144:569383..570389 (+ strand)
ATGTCTTCCTCTGCGGGCCGCCGCCTGGTCGGCAAGACCGTTGTCATCACCGGGGCATCCTCCGGCATCGGCCGGAGTAC
GGCCTTTGAGTTTGCGCGCACGGCCGCTTCTGCACCCAGCGGCAGCGGGATCCTGCGGCTGATTTTGACGGCGCGCCGCA
TTGACACGCTGAAGCAAATCGCCGAGGACCTCGTCAAGGAGGTCGGTGCCGACAAGGTCAAGGTGCTGCCGGTGCAGCTG
GACGTGAGCAAGCCGGAGGAGGTCAGCGCGTTTGTGGGCAAGCTGCCAGAGGAGTGGCGCGACATTCACATTCTCGTGAA
CAATGCGTGAGTTTGTCCTTGTTGTCTCGTCTTTCGTCTCGAGCTGACTTAGTGCAGCGGCCTCGTCAAGGGCGTCGCCC
GTGCGCCGGAGATTGCCGAGGCCGACGTCAACATCATGTTTGCGACCAACGTGACCGGCCTCATCAACGTGACGCAGGCG
ATCCTGCCGATCTTCCTCAAGCGGGCCGACGGCGGCTCTGGCGACATTATCAACATTGGCAGTATTGCGGGCATCGAGCC
ATATGCGGGCGGCGGGATCTACTGCGCCACCAAGGCAGCCGTTCGCAGCTTTTCGGAAAGCCTGCGCAAGGAGCTCATTC
ACACGCAGATCCGGGTGATCGAGGTCGATCCCGGCCAGGTCGAGACGGAGTTCTCGGTGGTGCGCTTCTACGGCGACAAG
TCCAAGGCCGATGCCGTCTATGCGTATGGCTTTTTCATTATCTCCTTTTTCTTCCTCCTTTTTCCAAAGAATGCTGCTAA
CTCCTCTTAGCGGCTACACCCCTCTGACGCCCGAAGACATTGCGGAGATCGTTGTGTTTACAGTCACACGGCCCCAGAAC
GTGGTCGTTGCCAACACACTGGTCTTCCCTCAGCACCAGGTGAGATTCCATTCCCTCCCACTCTACGAGTGCCCTGTCTA
ACCCCCTACAGGCCGGCGCCGGTACCCTGCACAAGAAGTCGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62