GenePrediction:GLEAN_1702 Details

Name: GLEAN_1702
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:570976..573974 (+ strand)
Length: 2999
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:570976..571989 (+ strand)
Length: 1014
Type: CDS
Source: GLEAN
Position: GCSC_144:572226..572709 (+ strand)
Length: 484
Type: CDS
Source: GLEAN
Position: GCSC_144:573082..573771 (+ strand)
Length: 690
Type: CDS
Source: GLEAN
Position: GCSC_144:573868..573974 (+ strand)
Length: 107
>GLEAN_1702 class=GenePrediction position=GCSC_144:570976..573974 (+ strand)
ATGGGACGGAAACCGAACCCCATTATCCTACAGTTTTTCGAGCGCGGACCGCGTCTCGCGGACAACAGCAACCGCTATCC
ACACCGATGCAAAGCATGCGGCGAGTCGTTTCCCAAGGGCCGGGCGGAGTCGCTGATGACGCACATTTCGAAGAAATGCC
CGGCCATCAGCGAGGCAGACCGAATCAACGCGTGTCTGTCGCTCAACGGGCTCAGCCACCACATTGCAGCAGCGGCAGCA
GCGTCAGCCGGCGGAGGAACAGGGGTCCGCGGGGCTGGACGGATGGCCCACCAGGCCCACCGGCTTGTGGGTGACGGCAG
CCATCACGGGCGCGGCAACGGACAGGCGATGAACCACGGCCACGGCCACGGCCACGGGCAGCACATGTTGCCGACGCTAG
GGATGTCTGCAGCAGCAGCGGCTTCGTCGCCCTCTTCGACGGTGGATGCAGCTGCGATTCAACGCGACTGGACGGCACTC
GAGACGCTGGCGGAGGTGTCACGCCAGATCGACCTAAGCGAGAAGCATGACGACCGCACGCCGGGGTCGTCTGGCAGCTC
AGGCGGGCCGGGCGGCGGCGAGGGAGCAGCGAAGAACGAAGGCGGCAACGGCGGCGGCAGCAATATGAACGCGTCGGGGA
CGACGACATCAGGCGGGCTGATCGCAGTGGCGCCGTCGGCGTTTGAGACGCTCGAGCACCTCGGCCAGGACGTGTCATCG
TTGTTTAAGACGGAGCAGAACGGTACGGCAGGCGAGAGAGAGGCGAAGAGACGGAAATACGCAGTCTCAGAGGCAGAGAG
TCATGCTGACGCACGCTTTGGGCTGTACGCAGACGACCCGGACGCGATCACGATTGAGCAGCTGAAGCGGCTCGAGGCGG
CGAACTTGTCGATGGCAGCGGCAGCTGCGGCGCAGCTGAACCCTTCGCTGCTGGACCCACAACTACGATCGGAAGAGGCG
ATGGGGCCCAACGCGACACGACTGCAGCAGCAGACGACGACGCCCGAAGCGAGGGTGACCTGGTGACGGCAGCGGTGACA
GAGGCGATGGCGACGACGACGGCAGCGACAGTGGCAGCGATGACGGCAGCGATGACGGCAACGGCCGGAGGGGGAGCAAC
AGCAGGACCGTCGGGCGAGGAGAACACGGGAGTGGAGACGGCGGTGATGACGGACGAGCCGATGACGACGGTGCCGATGA
CAGCAGTAGGACTGCTGCCAACGGTGGACGCAGCAACAGCATCGAGCCAGCCATGGGGCGAGATCACGTACCTGGCAGAA
AACATCTTGCCCGTGTTCCCGTCGTCGGAGATGTCGGCGAGTCCGGGCGACCCGAGCCGGATCAGCTTCCACCTGAACAA
CCCGAACGAGGCGCGGCCACGACAGGCACGGGCACGGTTCAACACGACGCGGCGGAAGGAGGTGCAGGAGGTGCGACGGA
TCGGGGCGTGCATCCGGTGCCGGATCCTGCGCAAGACGTGTTCCAAGGGCAGCCCATGCGATCAGTGCCGCAAAGTGCTG
TCGCCACGGGTGTGGCGGTCGGGCTGCGTGCGGACCAAGTTCACGGAGCAGCTGGATATCTTCTGCGCGGGCGTGCAGGT
GGTGCTGGCACAACACCGGGCCAACCAGCTGCGCGACACAGTCAGCGTGGTCAGCCGCGGACTGCTGATCGAGGCCACGC
ACTTTCCCGAGAACCCGGCGGTGGCGGTGACGCTGGAGGTGCTGCAGAGCAGCGGTCTGCTCGACACGGGCGCCGCAGCG
GCGGCAGCAGCAGCGACGGCAGCAGCAGCAGCGGCGGCAGCAACGACAGCAACGGCAGCAACGGCAGCAACGGCAGCAGC
AGCAGCAGCAGCAGCAGTGGCAGCGGCAGTGGAACGGGCAGGCAGCAGCAGTAGCAGCAGCGAGGGTGGCATGGTGGAGG
TGGCGATGAAGGTGGAAGGGAGCAGCAATAACGACACGGGCACGACAGCAACGCCAGGAGACAGCAGCGCGACGGGCGAA
GAGAACAACAACAACAACAGCGGCAGCAACAGCACGGCAGCAACAGCAACAGTAGCGGCGCCGCTGCATCTCTGGAAGGA
CGGGGAGATTGTGATGGTGGACACAGGGCGGGACGACGTGCCGCTCAAGATGGAGTACTACATGCGCAACGTGCTGCCGG
AGTTTATCCGGCGGGAACCGTCGCTGTTTGTGCGGACGCTGCTGGAGACGTCGATGGCGCTGGCGCAGGAGACGAACAGC
GTGCTGCTGCGCAAGGCGATTGAGCTGTGGGGATTGGTGGAGATTCTAGACCGTGAACGGCAGTGGCAGATTCGGGTGAA
GCCGGCAGCTGAAGGTGGTGTTGGTGTTGGTGTTGAGGCGCCGCGGCAGATCAAGGCGGAGACGGACCAGGAGACGTACA
CGACGCTCTGTCTGCAGCTGACGGCCGGGGCCGAGCGCAAGGCGGCAGCGATCAGCCACAGCCTGCTGACGACGATGCAG
CGGCTGCTGCAGGACAGCAAGACCAAGATCGACTACAGCATGTACTTTACCACGCTGATCCTGCTCAGCTGCGTCGAAAA
GTCCACCTGGGGCTTCAAGGCCTGGGACCAGGAGAGCCTGCGGGCCACCTGGCCGCTCGAGCGCACGCCCCAGGACTTTG
CCCAGCAGGGCTACGTCATCGCCGACCTGCTGCGCATGCTGCTGGGCATCCGGCGTGCCCTGCCGCGGACGTCGTGTCGG
GCCGAGGATGGCATGCTCGTCACGGACGACGAGGATCCGCTGATGCGCAACTTTTTCGACACGATCAAGCTGAACTGTGA
GTTTGCGTTGGTTTTTCATCCGTTTTTGCTTTTCTTCTTTTTCTTTTCTATTTTTTTCTTTTCTTTTCTTTTCTCCCCCA
CTAACATCCCAGACAACGACGTGGCCACAAAACAAGATCATCCCATCTTCTCGCCCACAGACTCGCGCTCCTTCGAGCTA
CTGTTCTGCTCGGCTCTGCTCCTGCCGGTGCGGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62