GenePrediction:GLEAN_1703 Details

Name: GLEAN_1703
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:578270..579843 (+ strand)
Length: 1574
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:578270..578356 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_144:578474..578530 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_144:578758..578967 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_144:579052..579843 (+ strand)
Length: 792
>GLEAN_1703 class=GenePrediction position=GCSC_144:578270..579843 (+ strand)
ATGCTGGCCGTCCGAGCTATTGCTGGCCCTGCCAGGCGCCAATGCTTCCGTGCAGCTCCCCGCGCGACTGCCACCATCAC
TCTGCAGGTACGTGCCGCCCTGTGCATGCGATCGTCCGAGGCCATCTCGGCCCCAAACTGAAGGGGCCTGAGCAGCTGCT
CTTGGTGAGCTTTTCACGTGCTGACTTGACCCCTCCCTACCTAGAACCAGAGATTCTACTCCAGCCGCGTTGCTGCCTTC
ACCGGAAAGAAAGATGCCAGCGTAAGCGATCACTGCACCTCATACTCGCTACAGCTTATCCCGTTCTGTTGTTGGGGCTG
CTGCGCTGCTCCGAACACTGCCGCGATCCCGCTGCGGATGTGCCGGCCTATTTCCAAATCTAGGCCGGCTTAAAGGGGAA
AAGTCGCGCGCGGACCAGACCCTCGCGGCAGCACTGGCGGTAACCAACAGAGGCGCGTGCAGATTGAAGCTGACCAACTT
TTCTGCAGGGCAACTACCCCGTCAGTCTGATCGAGGGCGACGGTATCGGCCCCGAGATCTCCCAGGCCGTGAAGGACATC
TTCGCCGCTGCCAAGGCTCCCATCTCCTGGGAGCCGGTCGATGTCACGCCCATTCTTGTCGACGGCAAGACCACCATTCC
ACCCGCTGCCATTGAGAGCATCAAGCGGAACAAGGTTGCCCTCAAGGGGCCCCTGGCTGTACGTTCAAAACTACGAAGCC
GCGGCTCGCCGCCAAGCCGCTATGGAACATGTCTTGCTGACGAACCCCCCTCCTCCCTCCAGACACCCATCGGCAAGGGC
CACGTCTCGCTCAACCTGACGCTGCGGAGAACGTTCAACCTGTTTGCGAACTTGCGTCCGTGTCGGTCCGTCGCCGGTTT
CAAGACACCCTATGACGGCGTCGACACGGTGCTGATTCGCGAGAACACCGAGGGCGAGTACTCGGGCATCGAGCACATCG
TGGTGGATGGCGTGGTGCAGAGCATCAAGCTGATCACGCGCGACGCCAGCGAGCGCGTGCTGCGCTTTGCCTTCCAGCAG
GCGCAGGAGATTGGCCGCACAAAGGTGCGCGTCGTGCACAAGGCCACCATCATGAAGCAGAGCGATGGCCTATTCCTAGC
TGTGGCCAAGGAGGTCGCCAAGGACTTTCCCGGCATCGAGTTTGACGACGAGCTGCTGGACAACACCTGCCTCAAGATGG
TCACCGACCCGACGCCCTACAACGACAAGGTCCTGGTCATGCCCAACCTGTACGGCGACATCCTGTCCGACATGAGCGCC
GGCCTGATCGGCGGCCTCGGCCTGACGCCCTCGGGCAACATTGGCGACGAGTGCTCCATCTTCGAGGCTGTCCACGGCTC
CGCCCCCGACATTGCCGGCAAGGCCCTGGCCAACCCGACCGCCCTGCTGCTCAGCTCCATGATGCTGCTGCGACACATGA
GCCTGGGCGACTACGCCGACCGGATCGAGAAGGCCGCCTTTGCCACGCTGGCCGAGGGCAAGGCACTGACTGGCGACTTG
GGTGGCAAGGCCAAGACCCACGAGTACACTGCCGCCATTATTGAGAAGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62