GenePrediction:GLEAN_1704 Details

Name: GLEAN_1704
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:580427..582136 (+ strand)
Length: 1710
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:580427..580451 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_144:580776..582136 (+ strand)
Length: 1361
>GLEAN_1704 class=GenePrediction position=GCSC_144:580427..582136 (+ strand)
ATGCCTCTACCGCTAGCTGCCCAAGGTAAGCGCTTCCACAGTGACGTCTGCCCGCCTATGTGCATATCCCCTCTAGCCCG
CCCCACCAGCCAAGCGCCCGCAACGCTGGCCCACCCTGAAACCTGGTGAAGGGTGGATAGGTGCATCAGCCCCGCCCATC
AAGCCATTCTCCGTAATCTTTCTGCCTGCGGCTCTGTGGCAAAGGATTGCGTAGGTTGGGCAAGAGGCCTCTGAGTGCCT
GGACTTACCGCCAACCTGCTTCGCCATCCCATTCCATCCTCTCCTTTCACGTTTACTCCTCTCTATCATACTGCATATTC
ACGTTCTCCGCTCTCTCTCTCTTGCACAGCCGGAGCACAGGAAGACGTCCGCTCATTCGAACCCCTCAACCGATTCCCCC
CTCCTCTTGAGATGCCTCCTATTCACCCTGTTGCCGTTACAGCTGGCGTTATCGCCTTGTCCGTGGCTGTGGCCACGGCC
ATCGCCATTTATGAGTCGCCGGAAGTGCGCCGCCGGGCCGACGAGCTCCGTCGCCGTATCGCCATTGCACTCCAGTCGCT
CAGCGACAACATTGCCCCCAACGACCACGCCCGGCCGGAACGCGAACCCATGTTCAACCGGCCGGAGGATGCGGAAGGTT
TCATGATGTCATCACACGGAGCCGGCGGCGACCCGAACGACGTGGTGGCCGACGAGGCCAGCAGGCGCCGCCAACGCGAG
GAGATCCTGTACTGGAATCGACAGCACCTAGAGCGACAGCGACAGCTGGAGGAGCAGGAGAAGCGCGAGGCCATCGCGGC
CGTCGAGAAGGCGACGCGGACGGCAGCGGAAGCGGCCGGGATTGACCCGTCGGCGCTGCCGCTGACGTCGTTCGACCAGC
TGCTCCGACCGGACGGCCAGGCCGAGAGAGGCACATTTGTGGTCAACACGGGTGCTGACTATGGCTACGACAACAACGGA
ACCGACGACCCGCTCAACGGCAGCATGGTCCGGCGACGCCGAGCCGAAGGCGTCCGCGGCCTCAACGCGTCTGTGTACAC
GAACCCGTTTAGCGACGAGTACGGCATCGAGCTGGACGAGCAGCACGACGCCACGCCCCAGCAGCACTCGCTCCGCGCAT
CTCTGCTCTCCCAGGGCGCCTACATCGCGCCCGAGGCCGACGAGCTGCTGTCCGACATCTACAATGCGTCCGAGCGCCCC
GAGACCCCAAGACCGACCAACAAGCCGGACGCCGCGGATGCTCCGTCGGCCGAGCTGCTGGAACTTGCCCTGGCTGAGAA
CGAGTTCTCGACGGCCGGACAGGACCCGCAGACCGACGACGGCGACGCCTACAACTCGATCCAGGCATGGGCCCACACAT
CGAGCTTTGCAAACGGCTTCTACTCGCCGCTGCCGGTGTCGCCGGTCGCAGCGCCGTCAGAGCCGGACGTGATCAGCGCG
GGTGAGCTGACGCCGACGGACTCGCTGTCGGTCGTGGACGCCCCGCTGCACACGTCAGAGAATGGCACGCGGGGTCCGGC
CACGACGGCCACGACGGCCACGGCCTCGACTACGGTTGTCGGCGACGCGGCATCCCAGGCAGGCTCGGGCCGGTACTACG
ACATGGTCAGCGACAGCGAGGACGGCGAGAGCCTAATGACGCCGACCAGCTGGACTGAGGTCGGCAGCGTGGTCAGCGAG
AGCGACGCAGGACGGCAGCGGCCGGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62