GenePrediction:GLEAN_1705 Details

Name: GLEAN_1705
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:582865..585694 (+ strand)
Length: 2830
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:582865..582940 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_144:583094..583167 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_144:583231..584196 (+ strand)
Length: 966
Type: CDS
Source: GLEAN
Position: GCSC_144:584279..584719 (+ strand)
Length: 441
Type: CDS
Source: GLEAN
Position: GCSC_144:585173..585694 (+ strand)
Length: 522
>GLEAN_1705 class=GenePrediction position=GCSC_144:582865..585694 (+ strand)
ATGAGGGGCCTCCTGGAGGCCGTTCTCCTCCTGGCATCGGTGTTGGTGCGAGACGCCGGTGCCGTATCTCATCAAGGTGA
GGATCCCCGCGATGGTCTTGTCATTGGATGATTGTGATACGTTTCGGGCATGTCGCTGCTGGTCCGTGTCTGTGTGGTGG
TCTCTGTGCCGTCTTGCTTTGTATCTGCTGTCTCGGATTGACATCTTGGCTGACGTCTTGTCGTATCAGAGAATGTGCCG
TCTTCTGCCTTTATCACCGTCAAGCTTCCCATTGCTCAGCTGAACGATGGGAACCCGTATCTGGTAACGTCTTCTCTCAG
CTGCCCTCCCTCACCCGAGAGATCGACGTGCTAACCGTTTCGTCAGAACTTCCGCTTTGATGTGCTCGAGTCGTCGGAGG
CTTGTGGCTTCGTCAACGCCACCGTCAACGGACAACTGCTGTCCACAGATGGCAGCATCGAGCTGCAGCTGGACCGCGAG
ACGACCGAGGCTGGCAGCGGTACCCCGGGCGTGATTACGGGCCACTGGTCCAGCGACTGTCTCGCATCCGACGACAAGAC
GCGCGAGCAGCGCCTTCAGCTGCGGGTATTGGCTTTCGACGGCGTGGCTCTGACGCGCGACGGCCCCGACGACAGCGACC
TGATCATCCGGTTCCGCCAGACGGCCCCCGTACGCATCATCGACATTGAGGGGGCAGCCAGTGCGTTCCGCTTTAATGAG
GTGCCGGCTCTCGTCGGCAACAACGATGGCCCGAATGCGGCTGCCGAGCTGGACGCGGCCGAGCTGGCGGCCTGGCAGCA
GAGCCTCGCGGCCATGCACCAGCACGCCCTCCTGATCCAGCACGACATCCGCGCCCGCGAGCAGTACATGCGGCAGCGCT
TTGGCGCCTCGTCCGTCAAGCTGGCCTGCTCGGACCGCTCCTTTCTCGGCGCCCTCTTCCACCGGATCACCAGCCTCATC
GGCAAGAGCAGCTGGGACGACGCCGCGATCCGGGTCCAGGACAGCACCGGTAGCCACAGCTGGGAACAGCTGTATCCACC
CCACGAGCCGCTCGTCTGTAGCAGCAACAACAGCCGTGCCGGCCCTCCACCGCCGCCGCCTCCCCCTCCTCCGTTTCTCC
TCCGCTGCGCAGCGCCGACCACGCCGAGCGAGGAGGAGGCCCACAACGATCCCGATCCCGATCCCGTCCATGACCATGAC
CACGACGACAACAGCGGCAGCGAAGAGGAGTTCGATCCGCCAGCTGAGAATGCTGGGTCAGATGAGGAGAACCAGGCAAG
CAGGCTCGGGACCTGGCCAGGGCACCAGAAGAACCATACGCACAACTACCGGGTATGTGATGGCCTTCCCCCTCAAGTGT
CCTTTGTCTTTCACGAACGCGAGGCTAACAGGTTGTGCTTTCTCTACGCTGCAGGGCATGTTTGCTTACATAATGACGAT
TGCGGCCATTTCTTGCCTCGTCATGTGCTCAGTGCACCATTTCCGAGACAGGATGCACGAGTGGCACGGTCACGACCGCG
ATGTGGAGGAAGGCGGCTCAGACAGCGGCGGTGTCTTTCGCAACAGGAACCGATGGCGGCGCGCAAACATCCGACGACAA
CTAACGGAACGGTGGCATAGTATTACGAGGAAGCACCGAGAGCGAATGGAACGCGGGCGAGCCAGCCGGCAAACCCGGCA
GCAGGTGCGTCGTGAGGATCGTAGGGACCGGATGAGTGTCGGTGCCAAGATCCTGTATTTCCTCAAGCGCATCCTCTCCG
GAAGGGGCCGCGATAGGGAGAAGCTGTTGGGCAGGTCTTCAAGAGGGCAAAACCAGCAGCCAGGAACAGCGCGCGGCCAC
ATCGAGGCAGTCGTGGTTCCGCCACCGTCGTCTCCGCGAGGATCATTCTCAGAGCAGCGAGAGGAACAGCCGGACGAGCA
GCAGCGGCTGCTGCAGGAGGCAGAACGGCAACAGCAACTGCAGCAGCAGCGAGACGATCAGCAGGTGCAGCGGCAACAGC
AACAGCAGCTTCAGCTTCAGCTCCAGCAACAACATCAACAGATCTTGCAACAGCAGCAGCTTCAGCAGCAGATTCAGCAG
CAGCGGCGGGAACGACAGGTGCGCGAACAGCAGCTACAAGAGCAGGAACAGCAGCTGCAGCTGCAGCTGCAGCAGCCACT
ACTACATCAGCAACTACGACATCCACAGCCACAACCACCACTACCACAGCCACAGCAGCCACAGCAGCCACAACAGCAGC
AAAACCAGCCACAACAACAAAAACAACAGCCCGAGCAGTATATGAAGAAACAACAGGGTGACTCCCAGACGCTCGGTGCC
GACCACGACCGCACGCCAAGTCCGACGATGGAACAAGAGATTGCGTCGTTCCGAGCGGCTGCCGACGTGGTGGACCAGAT
CATCGCAGCCGAAGAGGGCCGATTATCGGTGGCGCAGACGGCGAAGCTGAAACGGCAGCGGGAGCAGCAACAGACTTTAG
CATCGCTCTCGCGGCCATCGCCACCACCGCCGCCACCACCGTCGACGGTCTCGCCATTACCGCGTCCTGGCATCGCGACA
ACAACGTCAACATCGACCAGCCGCACGTCCTACGGCTACGATCGACGCGACCTCGGCGGCATTGACTACTCTGATTTTGA
CGACACGGAGTCGCTGCCACCTGCTTATTCCGAGACCGGCTTCGCGGAAGAGCCATATGCAGCGCCCGGTTCAATGACGG
CGCCAGCCGGCTTTGCCGAGTCTGCGTATTCGTACGTCGACCTCGCCGAAGCAGAGGCGTCAATGGTGGCCGACGGGTTC
CAGTACAATCCAGGCGGCAACAACTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62