GenePrediction:GLEAN_1706 Details

Name: GLEAN_1706
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:589041..589748 (+ strand)
Length: 708
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:589041..589059 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_144:589172..589190 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_144:589249..589342 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_144:589416..589748 (+ strand)
Length: 333
>GLEAN_1706 class=GenePrediction position=GCSC_144:589041..589748 (+ strand)
ATGGGCGTCGCTCTCCCTTGTATGCAACATCTACATCTACATTTACTCCCTCTCGCCTCCCGCCTCCCGCCTGCCGAGGG
CCGGAATGGGACCGGGTGGCCGTGACTGACAATGCTAATTGACCCTCACAGATGCAGTAGACGCCGAGACGTACGTGCCG
GATTACAACACTCCCTCTCCTTCCCCCTGGCTGACACGGTAGACACAGGCCGCTGAACGCGGCCGAGCTCCAAGTGCTGC
GTGCGCAATACGAGAAGGAGGGCGACATGGTGGGCGTGCAGACAAAGTTCAACTTTGCATGGGTAGGCATCTCCCCCTTG
GCAGCCGTGCGCCGGTCCGTGGTAGCAGACTCTTCCTGACACCCACACTCTCTAGGGCCTCGTCAAGTCGAATGTACGCG
GCGACCAGCAGCAGGGCGTCATGCTGCTGACCGAAATCTTCCGCACGTCTCCGGAACGACGCCGTGAGTGCCTCTACTAC
CTCGCCCTCGGCAACTACAAGCTGGGCAACTACGCCGAGGCCCGTCGCTACAACGACCTCTTGCTCGACAAGGAGCCTAC
CAACCAGCAGGCATCCAATCTCAACACGCTGATCGACGACAGGGTGCAGAAGGAGGGTCTGGTGGGCGTTGCCATTGTCA
GCGGCATCGCCGTCGTGGCTGGCGTCGTCGGCGGCGTGCTGCTGCGCAACATGGGCCGCCGGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62