GenePrediction:GLEAN_1707 Details

Name: GLEAN_1707
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:591409..593973 (+ strand)
Length: 2565
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:591409..591567 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_144:591639..592330 (+ strand)
Length: 692
Type: CDS
Source: GLEAN
Position: GCSC_144:592407..592793 (+ strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_144:593067..593973 (+ strand)
Length: 907
>GLEAN_1707 class=GenePrediction position=GCSC_144:591409..593973 (+ strand)
ATGTCTGCAAATTATCCACAGTCGCGCCAACAGCTCGATCGCCGCGATGGTCAAGATATCATCTACTGCCACAGATGCGA
GCATGAATGGTACCGTTCTAGCCGTGACTCGTCGCCACCGCCACCATGTCCGAGATGTGGCAGCGATGCCATAGAAACTG
TCAGTACTAGCGATCCCGTTTCTTGATGATCGCTGTCTTTACTGACTAGCTATTTCCGTCCCCCCAACAGGTCTCCGAGG
ATAGCGACCCGCGAGAGTTTCACGCGGGAGGCATAAACCCTTTTGAAGCGCTGATGGGCTTCGCCGGCTCTGGCAACGAT
CAATTTCGGCTCCATGACCTCCTACAACCCAGCGGCCCCGGCCATCTACACGATGACGACGATGGCGACTCTCCTTTTCC
TGGCAGCCCCGACCACCGCTCCCGTCGTCACAGCCACCGTCATGGTGCCGACCGTCACGGCTCAGCAAATGACTCCGACC
CAGAAGAGGCCGACATAGGCGAGGTGGAGGAACACGAGACGTATGGGCCCAACGGAATATACATGTACCGCACCGTCTCG
TCCTTCCCGAACGGCCGGTCAAGCAACGGTGGCACAAGAAGGACACCGTCGGGCAGGCCGGTCGGGGGTATCGATCCAAG
CGAACCAACGCATATCATAGCCACATTGGGCGAGTTTTTGAACAGCTTTAGGACAGTACAGGCAGGGCGGTCAGGCTCGG
AGATTCTGTTTGGCGGTCAGAACAACGGTCGCGGCAGCCGCGAAACGTTTGGTGGTTCAAGCCCAACTTTTGCAGACAGT
TCGGTCAGGCGGGTACAACAACCGACGTTTAGAGGTCCACGCCTCCGCAACGGCGTAACAAACGTCACCATCGCCACAGG
CCCGGTACGAATGGGAGGTAGACCATCGAGTGATTTTAACACGTATGTATATTGCTATCGAGCACTTTGTTCTGCGACTA
TGTAGACATATGCTGACCAGACATGTCTCTATGGACAGACACTTCACAAATATCACTAGCAACATGGGGCCTCCTACTTT
TGGAGAGGAACAGGAGAGGGCGACCGGCATACCGCCGGCGTTCCCGGACGCACTTCGCGGTCTGCTCGCAACACTTCTGA
GCAGCAGGGAGGGCCACGTCTTTGGCGATGCGGTGCATTCGGATGAGGCCTTGGATCGCATTATCACTATGCTGATGGAG
ACCAACCCGCCTTCGAACGGTGCGCCACCCGCGACACAGACGGCCATCGAGCGACTGGAGCACAAAAAGGTGGACGACAA
GCTGCTTGGCCCGGAGGGTCACGCTGAATGCACAATCTGCATATCGAGTGTTGAGCTGGGGGAAGACGTTGTCACGCTTC
CCTGCAAGCACTGGTTCCACGAGGAGTGCGTTGTCATGTGGCTGAAGCAGCACAATACCTGCCCTGTTTGCCGCAATCCA
GTGGAGAGCGGTGGTGCCGGAGCTGAGGGCGCGGCTGCAAACGGCAGCAGCAATAACAACAACGGTAACAACGGTAACAA
CGGTAACAACGGTAACAACGGTAACAACGGTAATAGCGGCAACGGCGGCAACAGCGGTAACAACAGTGCGGGCAGCAGCA
TCTTTGCAATGCCTATGCCTGGCGCCTACAACGACACTCCGGCTAGCACTCCTGGCAGTGCCTCTTTCGGCACGGCAAGC
TCTAGTCTAGGTGGTGACCGTGGCGGTGGCAACAGCCAGTCCGGGTTGGGAGGCATCCCGGGGGTGCTATTTTCGAGCGG
CTCTCGCGTGCCGATGGCGATGTCCAATGCACAGCAGACAGAGCGGCTCGAAGCTATACGAAGGAGTGCGGGTGTGCCTT
CCAACCGCTACCGCAGCCCACGGGACTCGGAGAGAACGTCGTCGTCGGATAGGAGACGACGCGATTCACACTCGCCGATT
CCTGGGCCGCCCTATCTCCCTGGTCGACGCTTCAACCTTGAACAGGACATGGAGGAATTTTATGGTGTGTTTGGTGTGAC
CCGTGAAGACTCGGCATCTTCGTCGCACAGCCGATGGAGCACGACTTCCCACAACAGCGGTAGCGGTGGCCAGAATGCGT
GGCTAGGCGGCGAAGCACAGCGCAGGTCTCGGGACCGGAACCCGGACCTAGGCCAACCTCGCGAACGCCAGCGTGAGCGG
CACCATGAGCGCATATGGTCAACGACGTCGCTCCGCGATCGGAACCGCAACTCCATGATTGCAGACCAGCTCCCCGGTGC
TGTTCCACCGGTCCGGCCGACGTCATGGTTGCCGGGTCGGTATATGAATTTCGGGGGTGACGGTGTCTACGACAGGGGCA
ACACAGGCACAGGCCCGAGTGGCGGCAACAGCAGTAGCAGTCGTATCTGCCACGACAACGGAAGTAGCTCAAGCATCGGC
AGTGGCCCTGTTACGGGTCCTGCTGCTGGCAACAACACGGGAAGCGAAGGCGCAGCTGGAAACGGCGGCCACACGAGCTC
ATCAGGGGGGATTTTCAGCTTCCTGAGTAGATTCAGGGATTCCGGCAACAACCAGTCGTCGTCCAGTTCCAGGAGGCGAT
CTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62