GenePrediction:GLEAN_1708 Details

Name: GLEAN_1708
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:596963..600772 (+ strand)
Length: 3810
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:596963..597537 (+ strand)
Length: 575
Type: CDS
Source: GLEAN
Position: GCSC_144:597896..598608 (+ strand)
Length: 713
Type: CDS
Source: GLEAN
Position: GCSC_144:598668..599378 (+ strand)
Length: 711
Type: CDS
Source: GLEAN
Position: GCSC_144:599802..600772 (+ strand)
Length: 971
>GLEAN_1708 class=GenePrediction position=GCSC_144:596963..600772 (+ strand)
ATGGATATAAAACGCTCGCCGGTGTACTATGAAGACTTTCCGGCCCATGATAGTATATATGCTGCATCCGGCCAGGATGG
ATTAAATACAGCTACTACCATCAGTCACACGGCTGGAAGCAGAAGTGGGAGAGTTGAAGTCGAAGCCAGCGCCGGGGGTC
ATGGCTTCATCGGCCACAATTACTCCGGACATAGTATGAACCTGAACACGCAAAGGAGGGACGATGCCGATGGTGATGGC
GAGTACGATTATGGCGTTGCGAGCTACGGCACCAATGGTGGCAACTATGCCGAAGGCGATTCGGCGAACATGTCAGCTAG
GGGCAGAAGCAAACCCGGACAAGGGGAGCAGCTGCCTCGCATAAGCCACCCCAGTAACAGCAGCAACAGCAACGACAACA
ATTCTGCGACCCAAAGCGTCAGCAGTGTCAGTAGCAGTAATGGGTATGTTTCTGCGACGCCCGGTGGTGGCAATTCTTTT
AGCTACAACGGAAGCAGTACAGAAAACGGCTATAGAAATGGCAGTTCTGAACTTCCAGACACCAATGCCAACGACGACAG
CTCGCCTACGGAGCCGTCTAAGAAGAAGCAAAAGCGCAACAAGCCAACATTGTCTTGTTCTGAATGTGTGGAACGGAAAA
CAAAGGTATGCAGTTCGTTCCACTGCATATTTGCCCACCACTGACTCGAGCGTTATCAGTGTGACCGTGGTCGACCTCAC
TGCCTTTCTTGTGAGTTCTTCCCGGAAGATAGTCTCCCATTTGTAAACAACAGAGTCCCGTCTGTCCTATCAAGCCGAAT
TGCTGACATAGAAAGGCATCAAACGTCAGACCGAATGCGTGTATGCTCATGTGGCGAATTTGCTCGAGTATGGCATGTCC
CTCAAAGTCGTTACGCCGTGCGCGATGCTAATTCTCTGTAGGGAAACTAACAGAACTGCCGCAGCAGCTGGTGGTCGCAG
GGTGACGCGGCCGCTATTGTCCAAGAAGAACACCGGATCTTCGTCCCTGATGTCGATCCCGAACATTGCCGATCGCGGCA
TCCTCAATGCGAAAAACGAATCTCAAGGCTCCGTCGCCCTCTCCACGGGACTGCTTGCCAATGCTCCTTACTCCGGATCC
ACTGCATCAAACGTCTTTGGAATTGGGTCTGAGCATCCCTTTGCCAACTATTGGACCTGCGAGGGCGGGTTGCCCGAGGT
CATCTCCGTCTTGCCTGACAAAGGGCAGTGCGACATGCTTCTCGTTCGCTACCTTGAATGTGTGGACCCCGTCTATCCCA
TGATTGACAGGCGATATTTCTACCACGACCTAGAGCAGTTCTGGGCGCTAGGACCGGACGACAGAGCTCGTGTTGATCCT
GCCTTCGTTGGCGTGCTCTTCGCTATGCTCGCCATAGGCACTCAATTTGTCACCGCTACTACATATAGCGAACGAAAGCA
AACTTCGGAGTTTTACGCGTCAGCAAGCAACCAGGCGTTACGTATTAGCTGCTACCTCAGTTCTGCCTCTATCCGCTCTA
TTCAGGCTATGGTCTTGGTTACCTACTTTCTCATCAACGACAACCATGCTTCTGATGGCTGGGCATTTGCCGGCATTCTT
ATGCGACAGGCTTGTGCCATGGGCCTGCACCGGGATCCGAATATAGGTCAGTGTTTTCATACTTGTCCGGTTACCACGAA
TGCCGTTTTGACTCCCTTTTTGAAGTGGCCCCAAATGCAAGTCCATATGAGAAGCAGCAACGCCGGAAGCTGTGGCAGGC
AGTTCTGTTGCAAGACACCTTCCTGACTATTCTTCTGTCGCTTCCACCAACAGCAACACACACGGACGTCAATGTGGAAG
AGCTAGAGGAGGAAGAGAGCGTGGATCCGAATTACGATACCAGCGTGACTGATACGGCCTATATTAGAGGCTCCTGGACT
CTGGCAAACTTGGTCCAAGAAGTCATAAGTAGCCCACGGTCGCTTGACGTTCCGATCTGCACCACGACACGCCACAAGTC
TAAGCTGGTCGCGGACTTTCGAGCGATATACCGCAGCTTTCCGGACATTTTCCGCAGCTGGGATCCAGAATCGCTGACCC
AACTTTCTCGAACCAACAAGCGGGTTGTGCGCCAGACGTTGTTTCTGAGCAGCAACTACTTCCACAACCTGATGTTGGTG
CATGCATCTGAGTCTCCCGACGTGCCTGTCAACGTGCGCGGTACTCTCGAGGCGGCACACGACGCCATCACGTCATTTTT
CGTGCTCTTCAAGCTCTTTCGAGACGAGGCCAGAGTCTGGTGGGTGTTCAACCACCGTGCCTTTTTGGAGGCCTTGTGCA
TAGGCGGTGTCTTGAAAGAGGCCGTTTACAAGAACGAAAATGGGACTGCAGGTGTTGCAAAGGACCCGTTATACGCACGC
GCCAGAGCGGACATCGGTACGTAGCTCATTGCCCTATCTTGAGAAGGATGTGGTACTAACAGCTGCAGAAAAAATGGTTG
AGATAATGCGCATAATGGGCGAAGGGGATCAAGGAGTCGATATAGCAAGAACAAGAGTCAAGGTTCTGAGCGAGTTTTTA
TAGGATCTTACTTGGGACGAACTGGCGTACAGGCGTATGGTCATATATGAGGGCTCCAGGATCTAGACAGCACATGCAGG
AAGCAAGCACATACATACACATGACCAAGAACCGGTCAATAGAAAACGCGCCAATAAGATACAACGATATATGCAGCGAT
GCTATGGGGGGTAGAAAGCGGTACTTTGAAGAGCGACCGAAGAAAGCCCTAGACAACGGCTGATAGGTGGGGGGTTTCCC
GATTTGGATTCGTCATCACGCTCTAGGCCCACGTCACAGCCAAAAGGCCCGGCAGTCCGGCAGCAGTCCACCAGCAAGCA
GCCCACCGGCAGCCCACCTACGGAGTAGACAAAAACGCGCACAGGCACATGTACGCAAGAGAATACAAGCAGATGATTAT
TCGGACGCCGGTTCCGTCGGCAGCGGCGGCGTCAGCTGGGATCGCCACAGCTGCACCGTGGCGCGCGCTCTTTCTGGAAC
ACCTGGCGCAGATGCCAGCACCGTTGGGTGCCGTCAGCACTCTACACCCCGGCGAGGCGACAGTGACGCCGCGGGTTCGC
CACTGTGTGTGTCGTGGGCTGTGGGCGTCTCTGCCGGACAATGCGCGCAACCCGGCGCGACGCAACCCTGCGGGCGTCTA
CGAGAGCGACCTGCCCGTGTTCACGACGGACGCGCGCATGGCCAAAGCATGGGAGCTGTCCGCATCAGCGCCAGCGTCCA
CATCAGTGCCAGCAGGAAGCGGCCACGGTGGCGGGCCGGTCGAGGCGGTGTGGTGGTCTGGGGCAGCCGGGACGCAGTGG
CGGGTGCGCGGACGGGCCTGGCTGCTGGGGCCGGACGCGGAGGATGCAGGCGGAGCTGTGGCACGAGCGGCCATCAGCCA
GCGGATGCGTCGTGTGGCAGGAGAGGGAGGAGAAGACGACTGGAGCTGGGCGCGAGAGGTGACAGGGCATTTTGGCAACA
TGAGTCCCGGTATGCGAGGCAGCTTCCGGAATCCGGCTCCGGGCACGGCACGATTGGACGAGGACAGGGGACTGGGCAAG
CCGGTGGACGATGACGACCTGGAAAACGCAGAGGCGCGGGCCAACTTCCGGGTGTGCGTGATCGTGCCGGAGGAGGTGGA
CCAGACGGACCTGTCGCGCGGAGACGATCCACGGCGATGGCTGTATACGTACGTGGGAGCGGGGGGTCAGGCGGTGCACA
AGGGCGGCGTGGTGGAGGGGGCGTGGGAGAAGCTGGAGGTATGGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62