GenePrediction:GLEAN_1709 Details

Name: GLEAN_1709
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:604223..606019 (+ strand)
Length: 1797
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:604223..604557 (+ strand)
Length: 335
Type: CDS
Source: GLEAN
Position: GCSC_144:604624..606019 (+ strand)
Length: 1396
>GLEAN_1709 class=GenePrediction position=GCSC_144:604223..606019 (+ strand)
ATGGTTCTCTACTCAAGTCCGCCGTCACTCCATCTCTTCTCTGAGGATAAGCCGACCCTGCTTGTCTGCTGGTGGATTAC
CTTTTTCTGCTGCACCGTCATTGTGCTTCGCATTGCTGGCCGGTACATTCGATCAGAGCGCCTTTTCGTCGAGGACAGAT
TCGTTGCCTACGCCATCATCCCTCTCTTCCTTCGCATGGGCTGTGTGCATATCATTCTCAAGTACGGCACCAACAACGCC
GATTTCAGTGGCGTCACGCTGTCTGAAACCCACCTCCGTCAGAAGCGAATCGCTAGTGGTCTAGTGATTGCGAGTCGCAT
TTTCCACGCCGCTACGTATGTGAACATCTCCCCGGCTTGGTATGTTGCCAGTGCGTTGTGAACTAACACGCCCCTCTTTA
GCCTCTGGATTCTCAAGATCACCATTCTTGAGTTCTTCAAGCGCATCAATGACGCCATTTCTGAGCGCTTCTCCCACGTT
TCCGTCATAATTATCCGCGTTTCCCTTGTGACCACATTCATTGCGGTCGTCATTAGCAGCCTCGCTGAATGTCACCCTTT
CTCTCACTACTGGCAGGTCCTTCCTGATCCGGGGGGCCAATGTCGGCAGGCTTACGCACAGCTGATCACCGCCTCAGCCT
GCAACATCTTCACCGACCTACTGCTCGTCTTCTTCCCTATTCCTATTATCATGTTCAGCCACCAGGCTCTAAAGCGAAGA
CTACAACTCGCCCTTCTCTTTTCCATGAGTCTGGGCGTCGTCGGTGTCACGTTTTACCGCGTCGTCGGTGTCCTCGATAC
TCATGGAAGTCAACAGCTTCGGTCTCTCTTGGCCTCGGTTGAACTCCTGTTCGCCACCACCGCTGCCAACGCTCTAGTGC
TTGGCTCGTTTGTCCGTGACCGCGGTGTCAAGAAAAACAAGTTCAGGGGTGGCTCTCTTGTCGACTCTATGGACCGCCCC
AGCATTGCACGATCACGTCGCCCAACTGTGAATCGCCATTGGGGGAGTGACGAGGACTTGGTTCGTGGCCTTGGCCTGGG
CGTTCATCCCACTTTACGCAATTCGCCTGAGATGCCCCAGGGAGACGATGTCATCTTCAGCAATACCTCGGTGCGAAATT
CGCGTCCTACGCCGACTGTCAGAGCCGACGACGAGCAGGAGGATGACAGCCAGCAGACCAGTAGCAACAACCGTGGTAGC
AGCGAGACTGGGATCGCGGACCTGCATTCGTGGCAATTTCCCGAGCGCAAGACGAGTGGCGGTACCCGCACTCAAAGTGC
CCAGAGCGCCCACAGCGGACAGAGCGAGGACGACAATCTGCTGAAAGATCCTCTCGGCACGTCCCCCCGGGCCAACCCCA
CCTCGGCAGCGCGAAAAGTCTCATTCTACGATGTGGGCGGCCTTCTCAGCAGTGACACGGCCGCAGACGATAACACCGCT
CAGCCGAGCCTTACCAGAACTCGGTCTGGGAGCATATCTGGGAGCCTGTCAACAAGTCAAAGTGTGCCGCCTTCGCCGGC
ATATACAGCTGGCAGCCACGGCTTCAGACGTGGATCCTCAGCTCTCTTGCAAGATCTGGGCGGCCTGCTAAGCTCACACC
CACGTCAAATTCCCGGCGGCAGAATTCCGGCAGAATTGCACCCGGTGCCCCAGGAGTCTCCCCTAGAGTCACCGTCTCCA
GCGACGCCGTTGCCGCTATTGACATCGTCTCCTATTCCCGTTTCTTCCCACGGCAATTTCGACGACATTGTATTAATGGA
TCCGGGTGGCCTGCTTAGCCAAAGTACGAAGCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62