GenePrediction:GLEAN_170 Details

Name: GLEAN_170
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1139840..1140850 (+ strand)
Length: 1011
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1139840..1139862 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_179:1140115..1140850 (+ strand)
Length: 736
>GLEAN_170 class=GenePrediction position=GCSC_179:1139840..1140850 (+ strand)
ATGTCTCGGCCTGAAGATACGCTGTAAGTTCAAGAAAGCCCGAACTGGCAACTTATTATCGTGCTAAATTTAGTTGTTAG
GACTGCAGATATTCACTACAATGATTCAGAAGCGCGGAAATACACCACGAGCTCCCGAATTCAGAATGTTCAAGCTTCGA
TGACACGACGTGCGCTAGAGTTGCTCGATCTTCCAGGGCCGAGTTTTATTCTTGACATCGGTTGTGGCAGTGGTTTATCT
GGCGAAATTTTGACGATGTCTGGGACAACAACAAGGCGGAGGAGGAGGAGGAACCACCTTGATGCTGCAACCGAAGGTGA
CGGCGGAACCGATGGTAGTGATGACGGCGAAGACGACGATGCTAGTATTGTCGAGGAAGAGGGAGGTGGACCGCATGTGT
GGGTTGGCATGGACATCAGCCCATCGATGCTGGATGTGGCTTTGCAACGTGATGTTGAAGGAGACCTTCTGTTAGCCGAC
ATGGGTCAAGGCGTACCGTTCCGGGCTGGGTCGTTCGACGCCGCCATCAGCATCAGCGCCTTGCAATGGTTGTGCAATGC
CGAGACCAGCGACACATCTCCCCAGGGCCGCCTGTCCCGTTTCTTCAACGGACTGTACGCATCGCTGCGGCGGGGTGGCC
GGGCCGTGTGCCAGTTCTATCCTAAGAACGACACGCAGCGGTCTATGATCACGCAAGCAGCAGTCCGCGCTGGCTTTGGT
GCCGGTATGCTGGAGGACGACCCAGGGACTAAAAACGTCAAGGTGTACCTTGTCCTCACTGTTGGGGGCAACGTCGCCAC
TGGAAACGGTGATATTACCGGCGTGGTCTCGGGTATGGACGGCGTCGACATCGTAGACGAGCGTCCAAGGGGGAAGAGCG
GTAGAGGTGTGGTGGTAAAAAAGGGAAGCAAGGCCTGGATTGCGAAGAAAAAAGAGCAGATGGAGCGCAAAGGAAAGATC
GTCAAGGCCAACTCGAAATACACAGGGAGAAAGCGGCGGATTGCTTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62