GenePrediction:GLEAN_1711 Details

Name: GLEAN_1711
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:615292..620217 (+ strand)
Length: 4926
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:615292..617114 (+ strand)
Length: 1823
Type: CDS
Source: GLEAN
Position: GCSC_144:617535..618128 (+ strand)
Length: 594
Type: CDS
Source: GLEAN
Position: GCSC_144:618231..620217 (+ strand)
Length: 1987
>GLEAN_1711 class=GenePrediction position=GCSC_144:615292..620217 (+ strand)
ATGGCGCCCTGGAGTTTAGGCGGCACGCCGCTTTTGCTGCCAATTCTACATCCATGTGTGCTTTTGCGGGGGACAGGGAC
GGCCGTCTGCCGGCGGCCAGCCGTCGCTCTGCCGCCGTGGCGCAGATACCAGACCGAGCGAACAGACGATGCAGCCACAG
CGGACGAAGAGGCGCCGACGGTGGCGTACCCGCCGTCACGACTGAACCCAGCGCCGGACGACTATGCGATGGCCAGCTTT
GCGGACAAGGCGACGCTGACGGTGCACGCAGGCGTGGGTGGCCAGGGCTGCATCTCGTTTTTACGCGACCTCTTTCTGCC
AGACGGGCCGCCCAACGGTGGTGACGGTGGCCACGGCGGCAACGTGTACATCCAAGCGGTGCCAGGCGAGACATCGCTGC
ACAAGATTGCGCGGCGGCGGGTGATGCGGGCCGGCCGCGGCAAGCATGGACAGGGCAGTGCGCGCAACGGACAGCGTGGC
GACGACGTGATCGTGACGGTGCCGGTGGGCACAATCGTGACCGAGGTCAGCCGAATCGATCCGGTGGCCGACGGGATCAT
CGTGGGAAAGGCGCGCCACGCAGCCCGCAAGCGCAAGCGGCAGCTGGCGGCAGCGGTCGTGGCGGCAGCACACGCCGAAG
AGATTGCGGCAGACGACGCGGAAGAGCAGAGATTGAAGACGGACGAGCGGCTGCGGCTCGAACAACGGCTGCGCCAGGAG
CAGGAGGACGACGAGGAGGCCGAGGCCGCCTGGCTGCGGCGTCGCTGGGTTGTCTACCCCGGACTGTCGTCGTCCGAGGT
GAAGAACATTGAGTTTCCGCGGTTGCCTAGACGCGATCGCACCTTGGCCCAACCACCGCCACCCGTCTACCTCGATCTCG
CCCGGCCGACGGCCCAGCCGATCCTGCTGGCGTCTGGCGGCGTCGGCGGGCTCGGCAATCCGCACTTTCTGTCGCGCAAG
ATGCCGCGGCCGGTCGTCGCCACCAAGGGCGAGGCTGCCGTGTCCATGACCATCAACCTGGAACTGCGCCTGCTCGCCGA
TGTCGGCCTTGTCGGCCTGCCCAATGCTGGCAAGAGTACGCTGCTGCGGGCTCTCAGCAACAGCCGTGCCCGTGTTGGCT
CCTGGGCCTTTACCACCTTGCAGCCCAACATTGGCACCGTCGTGCTTGACAGCAACCGTGGCCGTCCGCTTGTGGCAGTG
CGGCCGGCAAGCAGCCACGGCTCATCCGATACCGGCGAGTCTACCGACACACTGCCTCCCCGCACTCGCTTCACCGTTGC
CGACATCCCCGGCCTCATCGAGGGCGCCCACCTCGACAAGGGTCTCGGCATCGCGTTTCTGCGCCACGTCGAGCGTGCCG
GCGTCCTCGCCTTCGTCGTCGACCTCGGCGCTGGCGATGCCGTCAAGGCTGTCAAAGCCCTCTGGACCGAAGTCGGCCTG
TATGCCCGCATGCGCGATGAGGAGGAGCTGCAGCGCGAACGCGAGGCCAGGATCGAGTGGGGTGACCGGCCGGCCGGCCA
CGACGACGACGACCTTTCGGCCCTGTCTTGGACGTCTGGCAGCGACGTTGCTGCCCAGACGCCCGAGCTGGCCATTGCGG
GGAAGCCGTGGTTCGTCGTCGGCACAAAAGGCGATCTTCCCGGCGCCCAGGACAACTTCCAGCGCCTGCAGAACTATCTC
GACCGCATTACCAGCGGCCAGGAGTTGCATCCCAGCGGCATCCGCGGCGGCTGGACCGAGAAGCTTGCTGCCGTGCCCGT
CAGTGCAATCAAGGGCCATGGCATCGACCACATTGTCCACTGGACCGTCGGCTTGCTGGACCAGTAAATATGTAACTGTA
CCATGTACGATGTGGAATATACGCTGGGAGGTATAGAGTACGGGTGCAGGCATGTGACTTGCTCGAAAAATGATGTACTG
GGTACGCATTCTCATGCTACTGCAAGATAAGATAAGACTACAGCCGATAAGACGATAACAAGTGGGGCACGTTCAGTGTC
TTAATTTTTATTTTCTGACAGCCTCTTTTCGGTCTGCTCTTCCGTCTCTCAATTGAGGCTCAAAGGATCTGGCTTGCTTG
TATGAGCCCGAATTCAAGGCAACTTGAATACATCGGTCGACGGCTTACTTTCTCCACCGGGCAGACTACCAGCAGCACAA
TGGGTCGAGGGGGGTACAAGGTGAGAATGCATGTCAAGAGGAAAGAGAAGAGAAACAAAAGACCGACTGACACCGCCTCA
GAGAAACCGTGGCGGCCGGCGGCGCGACAACGCGCGGGCACCAAACAGCGGGGGCTTCCAGAAGACGTACCCGGACATTG
TCAAGGAGAACGAGCGGCTGCAGCAGTACTACAACGGGCTGCTGGAGCTGAACGACAAGGATGAGGAGCGTGAAGCGTTC
TGGGCGGCTTTCCGGCGCGAGCTGCCGCACAGCTTCCGGTTCTGCGGGTCCAAGGGTCACGCGCTGGCCGTGCAGAAGCT
GTTGCAGACGCGCTATATCCCGGAGCTGGCCAAGATCTCGCACTACGACGGCCTGCCGGTCTCGCCGCCTCAGCCGGTGC
CCTGGTATCCAGACAGCCTGGCCTGGTGGATGACCACGCCCAAGACGGTCATCCGCAAGTTCCCTCCCTTTGCCGCCTTC
CAGAAGTTCCTCGTGTCCGAGACGACCGTCGGCAACATCAGCCGCCAGGAGGTCGTTAGCATGATCCCACCCCTGCTGCT
AGACGTCCGTCCGGGCATGGCTGTTCTGGATCTCTGTGCCGCTCCCGGCAGCAAGGCCGCCCAGCTGCTGGAGATGCTGC
ACCAGGGCGAGGAAGCCCGCGTCCGCAAGGTGCTGCGGTCCATCGAGCGGGCCGACAAGGGAGAGAACGAGACGGCCGAA
GTCGACGACGACAACGACGACGACGACGACCCGACCGCGAAACTCTCGGCCGATCCCAGCGATGATGGCCGGGCCACCGG
CGTGCTGATTGCCAACGACTCCGACTACAAGCGCAGCCAGCTGCTGATCCACCAGCTGAAGCGCCTGTCGTCGCCCAACA
TCATCGTCACCAATCACGATGCCACCGTGTATCCGTCGCTCCGACTGCCACCTCTCGCGACCAGCAGCGAGTCCAAGCGG
CCGCCGCCCGTGCGCTACCTCAAGTTCGACCGCATCCTGGCCGATGTGCCGTGCTCGGGCGACGGGACCCTGCGCAAGAA
CGTCACCATGTGGAAGGACTGGACGCCGGCCGGTGCCCTGGGACTGCATCTCGTCCAGGTCCGCATCCTCGTGCGCGCCC
TGCAGATGCTTCGGCCTGGTGGCCGCGTCGTCTACTCGACCTGCAGCCTCAACCCGGTTGAGAACGAGGCCGTGGTGGCG
ACGGCCATCGACCTCTGCGGCGGGCCTGATCGCGTCGCCATCCTCGACAGCAGCGACAAGCTGCCGCTGCTCCAGCGTCG
ACCCGGCCTCAAGCGTTGGAGCATCATGGACCGCACCGGCCGCCAGTGGAGCAGCTGGCCTGAGGTCGAGGCTTACGTGG
CCTCGGACGAGAGCGGTGGCCTCGCCCCCAGCCGCGTTGTGCCCTCCATGTTTGCCAGCGAGGCGTCGGATGCCCTGCCG
CTCGAGCGCTGCATCCGCGTCTATCCCCATCTGCAGGACACCGGCGGCTTCTTCATCGTCGCGCTCGAGAAGAAGGCCGA
GTTCAAGCTCAAGCCGCTGCACCCTGGCGGCAACAGCACGCCGGTGGTCCAGCCGAAGACGGCCGATGTCGCCGAGACCG
AGACCGAGACCGAGAACGGCGACCGGACTGCAGCAAAACGGCCGGCCGAAGACGACGTCGACGGTACGGTTGACCCTGAC
AGCCTGGACGGCCATCTGCCCTCGACCAAGAAGTTGAAGCAGGAGGAGGATGCTCCGGAAGAGGCCGCTGTCGTCGGGGA
CACCGAGAGGACTGATGCTGAAAAGACCGAGGAGGCCAGCAAGACCAAGACCGACACGCCAGCCCCTGTCGACAAAGCCT
TGCCCGGACGTCCTCGTCATAGCGGCCCCTACGAGGAGCCGTTCAAGTACCTGGCCGCGGACCACCCGGTCGTCCAGGAG
ATCCGTGCCTTTTACAACCTCTCGCCGCGCTTCCCGGCCGACCGCTTCCTGGTGCGCAACGCCTACGGCGAGCCGGCCAA
GGGCATCTACTACACCAGCCAGCTGGTGCGGGATATCTTAGTCAGCAACACCTCAGACGGGTCACAGCAGCACAAAAAGC
AGCAGCAGCAGCAGCAACAACAGCAGGTGCGCGTCAAGTTTGTGCACGGTGGCGTGCGCATGTTTGTCAAGCAGGAGTCA
CCGTCGTCTGGCGTGTGCCGGTGGCGGATCCAGTCCGAAGGCATGCCGCTGCTGCAGGGATACGTCGGCGAGGAGCGCGT
GGTGCGGCTGTACCGCAAGACCACGCTGCGGTCGCTGCTGGTCGAGATGTTTCCCAAGTTTGCCGACGGCGGATGGAAGC
GGCTGGGCGAGGTCGGCCGCCGGCTGCCCGACATCGGCATGGGCTGCTTTGTGCTCAAGGTGGTGCCGGGGATGGAGGAT
ACAGAGGAGGTGGCCGAAGACGGAAATGCGGAAAATGCGGAAAACGCTGAAAACGCCGAAATCCCCGAAATCCCCGAAAC
TCCCGTCCTCGATGACAGCGTCCCGCTCGAGCCCATGGCCCTTCCCCTCTGGAAGAGCTTCCACTCGCTCAACCTGATGC
TGCCCAAGGAGGACCGCGCCGCCATGCTGCTGCGCATCTTCAACGACACCACGCCGCTGGTCAACAACACGCTCGAGCGA
AACAAGCAGCAGCACCAACCCCTGGCCCCTGCTATCCCCGAGGCTGACAAAGCCGCCGGTGAGCCCGTCGCTGTCAGCGA
CGCCCAGCTGAACGACTACGACGCAGAGGACGCGCCGTCGTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62