GenePrediction:GLEAN_1712 Details

Name: GLEAN_1712
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:626408..627849 (+ strand)
Length: 1442
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:626408..627252 (+ strand)
Length: 845
Type: CDS
Source: GLEAN
Position: GCSC_144:627318..627849 (+ strand)
Length: 532
>GLEAN_1712 class=GenePrediction position=GCSC_144:626408..627849 (+ strand)
ATGGTCCCATTCGCTCTCGGACGGCGCGGCCGGCCCTTGATGGCCCTGGCCCTGGCCCTCGGCGTGCTTGTGGCCTCCAG
CGGAATCGTGACCGTCTCGGCGGAGGTGGCAACATCCCAGGTGGCGGCTGGGTCGGCGACCGTGTCGAACGTGGCACGGC
TGCCGCCGCTGGGCTCGCTCGAGCTCAACGAGAAGTTGCGGGCCGAATGCGGGGTGGTGCGGGCGCTGGGCGAGCAGAAG
CGGCAGCTGCTGCTGCAGGGTGGCGACGAGGATGGCGAGGAGACGTCGTCGACCAAGTCGCGCCTCTTCTCGTTGTTGTT
TCCGGGCAGTCCGGCTGTGAACGCACTTCTGGCGACGCTCTACATCTCGGGACCGCCCAACTTTCTGCTGGCGCTCTGTC
CGACCGACATCGACCCAAGCTCGCTCTCGGTCATGGTGGCCTTTGCTGTTGGCGGCCTTCTCGGCGACACGCTCTTCCAC
CTGCTGCCCGAGATCTTTGTGGGCGAGGACGACGAGCGGGCTGATCGCGCTCGGCTCGTGCTGGTCGAGCCCAACCGCAA
CCTGCTCCTTGGCGTCGCCATCATGGTCGGCTTCATGACCTTTGTCGCCATGGACAAGGGCCTGCGCATCGCCACTGGCG
GCGGCGGTGGTCACGAGCACGGCCACAGCCACAGTCACAATGTCCCAGCCTCGGCCGTGACCTCGTCGGCCGACACGACG
TCTGCATCGGTCACGTCCCGCAAGAAGAGCTCCGGCAAGAAGGACGACAAGGCTGCTGTCGTCGCTGTCGAGTCGACGCA
TGAAGCCAGCGCCAGCATCAAGCTTTCCGGCTACCTGAACATGGTGTACGTTTCTTTCGTTTCCCCTTTTCGGCTTCTTC
TTGTCATTCTCCCCTTCTCTAACAGCCTAGCGCCGACTTTACACACAACATCACCGACGGTCTGGCCATGTCGGCCTCCT
TCTATGCGTCGCCGACGATCGGTGCAACCACTACGGTGGCCGTGTTCTTCCATGAGATCCCCCACGAGGTCGGCGATTTT
GCCCTGCTGGTGCAGTCTGGCTTCTCGAAGCGAGCAGCCCTGGGCGCCCAGTTCATCACGGCTCTCGGCGCGCTGCTGGG
CACGGTCATCGGTATCCTAGTGCAGGAGCTTGGCGGCAGCACCAGCGGCAGCACCATGACAAACTCGGCCGCTGCTCCCT
GGTCGGCCAGCGCTGGCCGAGGCGGCCTCATGGGCACCAGTCTGACGTGGGGGGACCTGCTGCTGCCTTTCACGGCGGGC
ACGTTTCTCTACGTCGGCACGGTGGCCGTCATCCCGGAGCTGCTCGAGACGGACCTGGAGAAGAAGGGCAGCAGCAAGCT
GGGCGAGCTGCGCAAGACGCTGGTGCAGTTTGGCGCCATTGCTGCCGGCGCTGGCATCATGCTCTACATTTCGTGGCAGT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62