GenePrediction:GLEAN_1717 Details

Name: GLEAN_1717
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:667697..671244 (+ strand)
Length: 3548
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:667697..671017 (+ strand)
Length: 3321
Type: CDS
Source: GLEAN
Position: GCSC_144:671080..671244 (+ strand)
Length: 165
>GLEAN_1717 class=GenePrediction position=GCSC_144:667697..671244 (+ strand)
ATGCTGAGACAACATGCAGTGCGGCGACTCGCAGCCAGGGGCGCCATTCGATACCCTAGACCAGCTCATTTCTCCTTGTT
GACGACAGCTACAGCTTCTGCAAGACCAAGACTTGCTCTGGTCTCAACGCCACGCAGTCCTGCGCAATGCCTTCATCCCC
AGGCCACAACACAGCTTCCGACCTTGGCACTTTTCTCGACGGCCTCCTCTTTACAGAAAAAGAGTCCGCGCGGATTTTTT
GATGGCTCGTCAGGCGCAGAGGGCGAGACCAAGCCTACTGCCGGAGCCCAGGAGGACGGAACACAGCCTGACGCATCCAA
GACGGAGTTGGAAAAGCCAAAGGAAGAGTCAGAGGCTGCCAAGTCCGGGTCTGAACCCCCGGCGGCGGCCAATCAAGGAA
ACTCGGAGCCTTCTGACGGGAAGGCTAGCAGCGGTGCGTCAAGCGGTGGAGGATCGAGTGGCGCGGGAAGCGATGGCGGA
TCGGGTGATGGTGGCCGGAGAGGAAGGAAGTCGGCCGACCGAGCTCTTCAAAAGCCCATTGTCCCGGACGTGTATCCTCA
GGTGATGGCAATTCCGATCGCGAAGCGCCCCCTGTTCCCCGGCTTCTACAAGGCGATCACGATCAAGGACCCGAACGTTG
CGAGCGCCATTACCGAGATGATCAAGCGAGGACAGCCTTATGTCGGTGCTTTTCTTTTCAAGGACGAGAACGCAGATGCC
GACGTGATACAAAGTGCGGACGAGGTCTACGATGTTGGTGTCTTTGCCCAAATCACCAGCGCCTTTCCCCTTCATGGCGA
GGGTGCGACGGGCCTTACAGCTATTCTCTACCCACACCGGCGCATTCGCCTTTCGACTCTCATCCCTCCTGGATCTGGTG
CCGACACCAGCACTGCTGATATTGTAGTCGAGGCTGATAAACCCGCAAGCGACGACCAGGCTAGCATCGAAGCTGTCCCG
GAGCCAATACCAGCGAAGGCGACGGAGGCAGAGGAGCCACAACCCGAGGAAAAGAAGGGTGACGTTGTGGCAAGCTTTGA
GGAGAGCGCGGTGGTTGTGCCTGCGAAGAGCGAGACGCCTGCACCTGTCCAGAAGCAAGCCACGCCGTACGAGCCGACTT
CTTTCCTCCGCAAGTTCGACGTCAGCCTCGTCAACGTGGAGAACCTGACGGAGGAACCATTCGACGCCAGGAGCCCCGTG
ATCCGTGCAGTCACCAACGAGATTGTCAACGTGTTCAAGGAGGTTGCGCAGATGAACAGCCTCTTCCGGGACCAGATTTC
GACGTTCTCGATGAGTCAGTCGGCGGGTCACGTGACAGCAGAGCCAGCAAAGCTTGCGGATTTTGCGGCTGCTGTGTCAG
CAGGTGACCCGGCAGAGCTGCAGGAGGTGCTGTCAAGCCTGAACGTGGAGGAGCGGATGCAGAAGGCACTTGTGGTGCTC
AAGAACGAGCTGATGAATGCCCAGCTCCAGTCCAAGATCACGCGGGAAGTCGAGAGCAAGATCACCAAGCGCCAGCGCGA
GTATTGGCTCATGGAGCAGATGAAGGGCATCCGGCGGGAGCTGGGAATAGAGTCTGACGGCAAAGACAAGCTGGTCGAGA
AGTTCAAAGAGAGGGCCGACAAGCTGGCGATGCCAGAGGCGGTGCGGAAGGTGTTTGATGACGAGATCAACAAGCTCGCC
CACCTGGAGCCGGCGGCATCGGAGTTCAACGTGACCCGGAACTACCTGGACTGGCTGACACAGATTCCGTGGGGCTTGCG
GAGTGCGGAGAACTTTGAGATCCAAAACGCAGTCGGCGTGCTGAACGAGGACCACTACGGGCTGAAGGATGTCAAAGACC
GGATTCTGGAGTTTATTGCTGTCGGCAAGCTCCGGGGCACGGTGGAGGGCAAGATTCTCTGCTTCGTAGGGCCGCCGGGC
GTGGGCAAGACGAGCATAGGAAAGTCCATTGCGCGCGCGCTCAACCGGCAGTACTACCGCTTCAGCGTTGGCGGTCTGAC
GGACGTGGCCGAGATCAAGGGACACCGGCGCACATACGTGGGGGCGCTCCCCGGCCGGGTGATCCAGGCACTGAAGAAGT
GCCAGACGGAGAACCCGCTGATCCTCATCGACGAGATTGACAAGATCGGCAAGGGTTACCAAGGCGACCCGTCGTCGGCT
CTTCTGGAGCTGCTAGATCCCGAGCAGAACAGCTCGTTCCTGGACCACTACATGGACGTGCCGGTCGACCTGTCCAAGGT
TCTGTTCGTCTGCACGGCGAACATGACCGACACTATCCCGCGGCCGCTGCTCGACCGCATGGAGGTCATCCGGCTGTCGG
GATACGTGTCGGACGAGAAGAGGGCCATTGCCGAGCGGTATCTCGCGCCGGCAGCCAAAGAGATGGCCGGGCTGAAGAAT
GCGGATGTGACGTTGAGCGACTCGGCCATCGAGGAGTTGATCAAATCGTATTGCCGCGAGTCCGGCGTGCGCAACTTGAA
GAAGCAGATCGAGAAGGTGTACCGCAAGTCTGCCCTCAAGATCGTGCAAGAGCTCGGCGAGGAAGGCCTTCCGGAGGCAG
CAGCGAAAGCAGACAGCTCCGCCGGGGAGAGCAAGGAGACAGAATCGACGGCGTCCACGGAGGACAGCACGTCCGAGCTG
GATTCGGTTCTTGGAGACGAGACAAGCTCGACGACGAGCACGACGGCCACTTCAACTACAACCTCGACGACCGGTCCGGA
GAAGCCACGGAAGGCACTGCAGGTACCGGAGTCTGTGCACGTAGTGATTGACGCTGAGAACCTCAAGGACTACGTCGGAC
CGCCGGTGTTCACGTCGGACCGGCTCTACGACGTGACGCCGCCGGGCGTGACGATGGGCCTGGCGTGGACACAGATGGGC
GGTGCAGCCATGTATGTGGAGACGATCCTGCAGGCAGCGCTGCGACCGAGCACGCGGCCGTCGCTCGAGATCACGGGCAA
CATCAAGGCGGTGATGAAGGAGTCGTCGACGATCGCGTACTCGTTTGCCAAGGCCATGATGGTCAAGGAGTTCCCGGACA
ACCACTTTTTCGACAAAGCCAAGCTGCACGTCCACGTGCCCGAAGGCGCGGTACAAAAGGACGGGCCGTCGGCGGGCATC
ACGATGGCGACGTCGCTGCTGTCGCTGGCGCTGGACTACCCGATCGACCCGACGGTGGCGATGACGGGCGAGCTGACGCT
GACGGGCAAGGTGCTGCGGATTGGCGGTCTGCGGGAGAAGACTATCGCAGCGCGGCGGGCCGGGTGCAAGCTGGTGGTAT
TTCCAGAGGACAACCTGTCTGACTGGCTGGAGTTGCCAGAGGTGAGTTTGCGAGCGAGCGGCGGGAGCAGATGCTCTTGG
TCCCGAGGCTAACATCGACGCAGAACATCAAGGAAGGGATCGAAGGACGGCCTGTCGGCTGGTACAAGGACGTGTTTGAG
ATCATCTTTGCTGGCTTGGACCGCGACCAGGCCAGCAAGTGCAAGATCTGCGAGTGGAAGAAGCAGCACGACGCCGACGA
GAAAGAGAAGGAGGACAAGGATGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62