GenePrediction:GLEAN_1718 Details

Name: GLEAN_1718
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:673987..677760 (+ strand)
Length: 3774
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:673987..674046 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_144:674140..674333 (+ strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_144:674741..676037 (+ strand)
Length: 1297
Type: CDS
Source: GLEAN
Position: GCSC_144:676105..677760 (+ strand)
Length: 1656
>GLEAN_1718 class=GenePrediction position=GCSC_144:673987..677760 (+ strand)
ATGAAGCAGAGCCACAACGAGCGCCAGTCAACTGCTGCCATCGTCTTCTTGACCGAACCGGTCGAGCGAGCCTGAAGGAG
AAAAGGCGTGAAAGGCGGCCGGAGTCTCCGTCGCCTGTCTGTCTGCACGGCATTGCGCCCTGACGCCGCGCAGCTGACGA
CCTTGGACCTCTTTGCCCCTGCTGATCTGTTGCCCTTCTGTCCTTTTGCCCTGGTGCCTTTTGCTACGTCGGAGAGGAGA
CCACACGAGACAGGACGACAACGTCCCCTGGATGGAGAAGCAATACGTAGCAACAGGACCGAACAGCCCAGCAACCGCCG
GGAAGAAAAAGCCATCGTCAAGTCCGGGTCCACCGCAACCCAATCCATAAACAGAAAAACATCGCCGCTCTCCAAGCAAA
AAAGAGTCCTCGCACCTGACTGACATCCTCACCGCCGTCTCTACATCCACACTTCAGCCCAAACTGCCACCTCCGCGGAC
CTGCTCGTATCCGGGCGTCTACTTGGCGTGCGGCTTTGCCCAAGGAATTCTCAACATCCTTCCCAGATAGGCTCACTGCA
CCATCACGGACTCAACTCTCTGCTTACAGCTGTTCGCAACTCTTTCGGCACCGCCTACCCTTCACCGTTCACCTTCCTGC
CTGCACTCTGCGGGCCCACACCACAAAAACGCGTCCACTCACTGACTTTGCGTGTTTCCACTGCTCCATCAAACCTTCAA
GCTGGTTACCCACAAAGAAACCTTCACTGCATAGGGCCAACGGTGCTACTCTGGCAGAGGCAGCCTCGTCTGCACCTGCG
CCCTCTCGCGGCAATTCCATGGCTCAGCCTGGTTTGGCGCCTGAGGACTCACGGGCCGGAGGGCCCCAAACTTCGCCAAC
ATCACGGCCACCACCGCCGGCTGTTCCACCTTCGCCGGTCAGAAGTCTCTGGAGGAGATTTCTGTCCAGGGGCGTGCACT
CCACCAGGCATGGCGTATCACCAACACCTTCGGCGAAAGCTCCTCCGGCTGCCTTGCCAGGCAAACGGACCGCCAGCCAT
GATGTACCTCGCCAGCCCGTTACAACCGTTGCTGTCAAACCTGTGAGCCCGGCGAGCCCGGTGAGCCCGGTGAGCTCTTT
GAGCCCTGCGAACCCTGCCAGTCCTCCAGTTTTCAATGCTGCAGCCTCGAAACCGAGTGGAAGCAGTCGCCGACCGCATC
GAGAGGTTGTCCCCGGCCTGCCCCGTGCTCAGACGTTTGCCCGGCAGCAGTCGGAACTCCGTGAGAATCTTCTGGCCGTG
AAACCCTCGCCAGATGAACGACGAGCAACTTCCATGGACCGGCGTCTATTGCACTCAGCCAAGTCTCTGTCTACTTCGCA
GACCACAGCGAATCCGCGAGCAAGTGCGCCCAATTTCGGACACGGTCCCCGGAAAAGTGCCCCTGACTTTGTGACGTTGG
ACAGCCCTGGCACATCTCACGTTGCACCACATGTCCCACTGGCGCCATCCCTCAAGTCAGAGCCATCAGCCGGTGCTCTG
ACCAGTGAAGGCACCGGAAACGACGGCACAGTGGCTTCCACCAACCGGAATGCCGGTGATGCTGCTCCTAGTGCCACCTA
CAGCGACCTCCATGGCTCTTTGAACAAACTGCAGCAGCACCACCAGGACGACACGTTCCATTTGGTAGAGAGAGCGTCTC
TCATCGACACTGCTTCCATGACGTCGTCCCAGTACGAACAGACCCTTCTTTACGAGCTGGAGCACATCTGGATTCTGAAT
CTGTCAATGCACTTCCGCGACAAGTCGAGGCGGGAGAAGTTTTTCGTCACCTACCGTCAACGTCCCGACCTATGGCGGAG
AGTGACTGTCTCGCTCGACTACCGCAATGCGCCTGAAAACTCGCTGGAGATGGATCTGTTGCATACCAAGTTCCAGCGTG
ACAAGAACGAAAAGATCTACGAGGCCATCCGCGAAAGCCTTTCCAGCATACAGTTCTACGAGACCGTAACAAACCTCAAG
TTGCAAACGACAGACGGTCGTTTGCATGTTCATGTTGTCGAAGACGTCACGGTTTGTCCTCCTCGCCCTCCTCCTTCTCC
CAAGTAGCATTCGCTAGGTTCAGCTCTGACACGCGCAGGAAATCATCAAATATCCCACCAGTCGCATGGTACAACATCTG
AGCTGCCGAATAATCAGAGAGCGTGCAATTGAGTTCGACTCACACATGTCCGGATTTGTTTACAAAGTGCGCGTGGACGG
ACGGATGCTCATCAAAAAGGAAATACCTGGTCCTGATTCTGTGGATGAGTTCTTGTATGAGGTCAATGCGCTGAACTTCC
TTTCCCACTCTCGCAATGTCATTGAGTTCTACGGGGTCATTGTGAACGAGCACGACTGCGTCACAGGCCTTCTCATCGAC
TTCGCCGAGCAGGGGGCTTTGATCGATATAATCTACGACAGCGACCACGGCATTCCTTGGCCCACACGCGCCAAATGGGC
ACGTCAGATTGTCCAGGGCCTCTCGGAGATCCACGAGGCCGGCTATGTGCAGGGCGACTTCACCCTCTCGAACATTGTCA
TTGACGACAATGGCAATGCCAAGATCATCGACATCAACAGACGCGGCTGTCCAGTGGGCTGGGAGCCGCCCGAGGCAACG
CCGCTCATCGAGAACAAGCAGCGCATATCGATGTACATTGGCGTCAAGTCGGATCTCTACCAGCTTGGCATGGTGCTGTG
GGCTCTCACCATGCAAGACGACGAGCCTGAAGCCCATCATCGGCCATTGCATCTGCCTGGAGATGTCACCGTACCGTCCT
GGTTCCGGACCATCGTCGAGACTTGTCTAGAGGAAGACCCGAGGGCTCGTGCTCAAGCCAGCCAGCTGGTCCGCCTCTTC
CCTGTTCCAGAAGGCCGGTCCGATCACTCGGACATCAGTGATTACGACGAAGTTGACTGGGTGGGAGATCGCCGCCCTCC
TGGTCTCTTTGAGCACAATCCTCCTTTACGTGTTGGTGACGACTCTGTCTTCTTGCGGAACGACACCGCAGTTCTCAGAG
GCCCCGTGGGCTATTCGGATGATGCCGACACGGGCTTGGACAGCTACCCGGCCGATGGCGTGACGGCATCATCGAGCGAC
TGGTCCTACGTGCACATCGAGACTGCTCCCACCGATTCGGTGCCACGTGTCACCAACGAGAAGTACTCCTACCCGGCAAG
GGGTCGGTCGCCGCCCAACGCTCGTCGGAGAAGCTACAACCACAACTCCCAAAACAGCTTTTCCGACGACAAGCATGACT
CGCCAGACGTGGAGAGGCAGCAGCACAGAAGACCGATTGGTGATGGGGGGAGGCGGCCAACGACTCCCACTTTCAGTCCA
GGTGCCGATCCTTCCACCCCCAAGGAGAGTGCTTTGCGTCGAACAGGCAGGATGGTCGAAGGCGCAGCCGCTAGCGGCGT
ACTGGAGCCTGAATCCGCGGTCGCGGACGTCGGCGGCAACATCGACGAGTTTGATCCAGAAGATGACGGGGCTTCTGTGA
CCACAGCGGGACGTCCAACTCCCCCCCCAACAGGTGACTCTACTGAGGAAAGCCATATGGATTTTCTGCCGACTGAAGGG
CCACAGCACAATGAAAGTCAGGCCGAAACATCTTTGGCAGCCTCAAACCAGCCTGACCAAGAATCCTCGAATTCAAAGGC
TGCGGAGGAGTTAGACTCTGGAAACAATTCTTCAAGCGAATCTTCCGACGGGGGTACAGCACTGGAAAACGCAAAGGGCA
GAGCACGGCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62