GenePrediction:GLEAN_1719 Details

Name: GLEAN_1719
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:679879..681353 (+ strand)
Length: 1475
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:679879..680155 (+ strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_144:680218..681353 (+ strand)
Length: 1136
>GLEAN_1719 class=GenePrediction position=GCSC_144:679879..681353 (+ strand)
ATGGCGGCCAAAATCGAGGTAGCCGATGCTACCGTCGATGGCACTACGGACTTCAAGCCTCTGCGGTCCAAGCAGTATGA
CATCCGGAAACAACACATCTCAGAGCTTCCTATCACGCTTAGCAACTGGTACAAGCACATTGACTGGCTGAATGTCACGT
TTATTCTCCTTATTCCTCTGGCCGGGTTTATCTACGCATACTGGGTACCCTTGCATTTCTATACTTTCATTTTCGCCATC
GTGTACTACTTCAACACTGGCCTGGGTATTACAGCAGGTAAGCCGCCCTCCTGCATCCCGCAGCGTGCAGGGTCGAGAGG
CTAACATGGGGACTTCCAGGCTACCACCGCCTCTGGGCACACACTTCGTACAAGGCATCGCTCCCGCTACAGATCTACCT
CGCTGCTGTTGGTGCCGGTGCTGTGGAAGGCTCGATCCGCTGGTGGTCTCGCGGCCACCGTGCCCACCACCGGTACACCG
ACACCGACAAGGACCCTTACTCCGTCCGCAAGGGCCTGCTCTACTCGCACATTGGCTGGATGGTGATGAAGCAGAACCCC
AAGCGTATCGGCCGCACCGATATCACTGACCTGAACGAGGACCCCGTTGTCGTCTGGCAGCACAAGCACTACATCAAGAC
AGTTCTGACCATGGGCATCTTCTTCCCTATGCTCGTCTGCGGTCTGGGCTGGGGCGACTGGCTCGGCGGCTTTGTGTACG
CCGGCATCATCCGCATCTTTGTTGTGCAGCAGGCCACCTTTTGCGTCAACTCTCTCGCTCACTGGCTCGGAGACCAGCCG
TTTGACGACCGCAACTCGCCACGTGACCATGTCATCACTGCTCTCGTTACTCTTGGTGAGGGCTACCACAACTTCCACCA
CGAGTTCCCGTCCGACTACCGGAACGCGATTGAGTGGTGGCAGTACGACCCGACCAAGTGGTCCATCTGGCTCTGGAAGC
AGATGGGCCTGGCCTACGACCTGAAGGAGTTCCGCCAGAACGAGATCGACAAGGGCCGGCTGCAGCAGCAGCAGAAGAAG
CTCGACCAGAAGCGCGCGACGCTGGACTGGGGTACTCCCTTGGAGCAGCTGCCTGTCGTGGACTGGGACGACTTTGTTGA
GCAGACCAAGAACGGCAAGGCGCTGGTGGCTATTGCGGGTGTCGTCCACGATGTGACGGCGTTTGTGCAGGACCACCCGG
GCGGCAAGGCACTGATCAAGTCTGCAATCGGCAAGGACGCTACAGCAATTTTCAATGGCGGCGTATATAACCACTCCAAC
GCCGCACACAACTTGCTGTCGACTATGCGCGTGGGTGTCCTTCGTGGCGGCTGCGAGGTGGAGATCTGGAAGCGCGCCCA
CTACGAGAGCAAGGACATATCTTATGCCACCGACTCTGCCGGACGCCGTATTGTCCGTGCCGGCGAGCAGGTGACTCGAG
CATCTGTGCCCATTGCAACGGCGAGCGCCGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62