GenePrediction:GLEAN_171 Details

Name: GLEAN_171
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:1143807..1146112 (+ strand)
Length: 2306
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:1143807..1145498 (+ strand)
Length: 1692
Type: CDS
Source: GLEAN
Position: GCSC_179:1145609..1146112 (+ strand)
Length: 504
>GLEAN_171 class=GenePrediction position=GCSC_179:1143807..1146112 (+ strand)
ATGATATACGAGCAAGCCGTCGATTTCACCGCCCCCAGCCCGGGCTCGCCACCGGGCATGACTGCCTCCAAATCCTCCAA
ATCCTCCTCGTTCCACTCGATCAGTTCCGACGACAACAGCGTTCTATCAGATGTCAACCACTTCGAAGATATCGGTCTTG
ACGACGACACGATCCCCCGCCATGACCGGGACAATATCAAAAGCCAGCCGAACCGGTTCTCTCCTTCATTCTCCGCCGAC
CTTAGGGTCGCTTCTTTACAACAAAAAGGCCCGCACACACATGCACATATGTCGCGGGACCTAGCGAATATACGCCGCCC
AAATGCATCGCCCAACAGCCGCCCGTCCTATCCCAGCCTGCAAACACAAGTCCGATCCGTAAATGTGCGCAGCACGCACA
CCAATACTCTTCTTCCCGAGGCATCGTCTGCGAGAAGCCTATCAAGATCTTCGTCGCTTTCATTTCGCCATCGAAGCCCA
AGCCCTCGTGTTCATTCGACTCCTGGCCTGAAAAACCCTTCATTACCGGCGAAGCTTAGGAGGAGCAGCTGGCAACCGAC
ACGTGAGCGAAAGACATCGTTGGAGCTGGAGCTGGAGTGCGATGAGGACGAAGGCGACGACATCCCAGACGGGCTCGTTT
TAGACAACGTGCCAATCTCGCCACGGCCGCCGTCAGAGCGCTCTCGACCCGTCAGCTCTGCAAGTTCTAAGACCGGCTCA
CCTGATCGTGGTTCCAAAGATAAGCGCAAAAGCGTGGGAAATGGTACGCCGCCGGTTGCTATCGCCCAAGGGTCGCTGCG
GTCACCGGCATGGAGATCCGAGGCGCTCAAATCGCCCGGGGAGATGCCTGGTCCGGTCAAGATGCGGGCGAAGAGCTGGA
CTGCCGCACTTTCTGAGCTGAGTCTAGAAGCTAAAGTCCTGACGGAAAAGCTGGAAGAGCACGCGGACGAGTTGCAGCAG
AAGGCACAGCGGTCTAGCACGGGCTCCATGCCTGTTGTACGACGAATTGTGACGGACCCTGTGAACAACAAACCGCGGCA
CAATTCGGCTCATCCGGAACTCCCGCCTCTTCGGCGAAGCAACATCATGATCGACCCGCTCCCGGTGTCGAAGGAAAAGG
AGGCCGTACTCTCCCGGACCCGCCCATCGTGGCTGCCGCCCAAGGATCCTGCCGAAGAACGACGGCATCTGAAGGAGTAC
CAGAAGATGATGGCTCACAGCGCCGAGGCAGAGCGCCGCCGCGAGGCGGACCGCCGTGCACGGTCAGACTGTCGGGACAC
TGCCGCAAAGGGCCTGATGCAAATTTGGGAGCAGGACATCATTCCACGGTGGTCAGAAGCGGTCAGGGAACGCCGAACCC
GCGAACTTTGGTGGCGAGGAGTTGCACCACGGAGCAGAGGTGGCGTCTGGGCAAGAGCCATCGGAAACGAACTAGGCCTG
ACAGAAATGTCATTCCAGGCAGCGCTCGGACGAGCTAGTGAGGTGGAGGCGCGCATCAAAGCTCAGACTGGAACACCGGA
CGACGAACGCTATGCGTCACATTTTGCCGCGATTCGTAGAGACGTTGAGCACTCTACATGGAAAGATTTGAAGATCTTCC
AGGCTGGCGCACCGCTCAACCTCGGCTTGATGGACGTTCTGATGGCATATTCCATGTACCGAAGTGACATCGGGTATGTC
TCGGGCTGCAACGTAAGTGATTTTAGATGGCCTTTTTCCAGGATGACCGTGGCATGAAAGGCGTGCCGTTCCTTTCATAT
TTAGCTCAAAGCTTGGTGCATGTATCGCTGACAATTTCACAGACCATTGCAGCTCTGCTGCTTCTGAACCTGCCTGGTCC
TGCATCAGCTTTTGTTGCATTGGCAAATGTACTGAACCGCCCGCTTCCGCTCAGTTTTTACGCCGCAGATTCTGGTGCCA
AATCGTCGGCTTATAATCTGCTCTTGCAGACCCTGTTGGCAAAGTCTCCTGCTTTGTACTATCACATCACCAGCTTCCCT
GACCATGAGCCCGACTATTGTTTCGGAAGTTTATTCACGTCCTTGTTCACAAACTGCCTTGCTCTGGACGAAGCTGCCCG
GCTCTGGGACGTCTATGTTTTCGAGGGCGACGCGATACTAGTTCATGCTGGCGTTGCATATGTCATGGGGAAGGAAATGG
AGCTTTTGGGGGCTAAGAACCAGGAGGAGATTCGCTCGATCCTCCACCGCTATGAGGACGGCCATGGTGGACGCCGAGCT
GTTGTTGCCCAGTCGGGCGAAGAAGACCGCTGGATGAAGTCAGTCAGAGCAGTCGGTAAGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62