GenePrediction:GLEAN_1721 Details

Name: GLEAN_1721
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:688615..689193 (+ strand)
Length: 579
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:688615..688657 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_144:688752..688813 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_144:688870..689127 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_144:689182..689193 (+ strand)
Length: 12
>GLEAN_1721 class=GenePrediction position=GCSC_144:688615..689193 (+ strand)
ATGGCCATCTCCCCTTCCGAATTTGCGCGCGTGACGCGGCAGTGTACGTCGGAACAGGCTGTCTCTGCCTTTCCCCTCTT
CCTTTCCCTTCCTGCCGGACTGTTCCGGACGAGCGCTGACGAGAGGCCTGTTCACAGCTACGAGCTGGGCCGAGGCGAGG
CGGAGAGTGCTGTCGGCATACCGCGAATGGATCCGAGCTGTACGTCCCGGAGAGGCATCCAGGTGGGATTGGCAGGAAGC
TGACCTCGCTCGCAGGCTCCGGAGATCCAGACGATGTATCAGGTACCGCTGCCGGTGGCAGTAGTGCGGACACGGATCCG
ACAGGAGTTTGAGCGACACCGGTTTGTCAACAAGCTGCCGGTGGTGGACGTGCTCCTGTTCCAGAGCTCGGCCGACTACC
AGGAGACGCGCAACTTCTGGCGGCAGACGCCGCACGTCATGGCCTTCTTCAAGGAGGAGACGATCCGGGGCGAGAAGAAG
CTGCCGTCCAGTTTCATGCAGGGCTTTCTCGAGGTACGTCCCGTTTTCGTGCCTGTAAGCTGTCTAGAGGGATGCTGACG
ACAACAGGGCCGCAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62