GenePrediction:GLEAN_1724 Details

Name: GLEAN_1724
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:717864..718429 (+ strand)
Length: 566
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:717864..717900 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_144:717977..717990 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_144:718054..718257 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_144:718313..718429 (+ strand)
Length: 117
>GLEAN_1724 class=GenePrediction position=GCSC_144:717864..718429 (+ strand)
ATGTCTTCCATCGTTCTCTCCCAGGACGCGGCTCCCCGTAAGTCGCACCCGAGGGACAGAGTTTTTTTGGTGCTGGCCCG
GCCTTTTGTCACTAACCGAGTTCTTCATCGCAGCCGCCGGCCCCTACGTATGAGCTTCTTGCCCTGTCTCCCCGCCTGTC
CTCCACCCATTAACCTGACCCCCACTACAGTCCCAGGCGATCAAGACGCCGTTTGCCATCTTCTGCTCCGGTCAGATCCC
AGCCGACAAGGACGGCAACCTGATCGAGGGCACCATCCAGGAGAAGACTGCTGCCTGCATCAAGTCTCTCCAGGCCGTGC
TGACTGCGGCCGGCTCGTCGCTGGACAAGGTGGTCAAGGTCAACGTCTTCCTGGTCGACATGGGCCAGTTCGCGGTAGGT
CTACAGACACACGGACAGACGGACCCACGTGTACATGCTGACTGGTCAGAGCGTCAACGAAGAGTACGGCAAGTGGTTCA
CGAACAAGCCGGCTCGCAGCTGCGTCGCCGTCAAGACGCTGCCCAAGAACGTCGACATCGAGATCGAGTGCATTGCGCTC
CCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62